“How did you come about to work at Z-Tech in the first place,” asked Polly.
“Once upon a time, I believe it was around 15 B.G. (Before Google), a fellow asked me,
“Do you want a job in Z-Tech’s Culinary Department?”
“I don’t recall exactly what the job entailed but it had something to do with determining the edibleness of wild mushrooms and clinical trials in the first stage of FDA approval. The amount offered was prodigious and my main thought was, ‘hopefully I get into the placebo group.’ But due to a deep-seated aversion to gambling and a very religious upbringing forbidding drugs and alcoholic beverages, apart from Vanilla flavoring, declined the offer.
That’s not to say I didn’t think about it. With the extra money I could start a side business raising emus on a ranch with salmon and trout streams. Emus lay the world’s second largest egg and one can make Faberge-like egg-purses for the rich and fragile. The omelets would be huge…something like 14 regular chicken eggs equals one emu egg with the only danger being a really bad case of Salmonella.
I could quit the part-time gig as an Elmo mascot at the local kid’s museum and tell people I’m an Anthromycologist at parties serving expensive hors d’oeurves consisting of rare fish, goat cheese, and the non-lethal mushrooms. Mrs. Perez, the beautiful, charming, and witty Mrs. Perez…we met at the university cafeteria and knew we were made for each other when we discovered a mutual interest in big birds, trash-can dwelling life forms, and snuffleupagus sightings…would be at my side. The rich people would come bearing gifts of gold, frankincense, and $25 Starbucks gift certificates and sing praises to my name call me blessed one and a really fun guy. I would wax eloquent and give my opinion on alternatives to an NCAA D1 football playoff system called Stimulus II. And when they ask me deep philosophical questions such as,
“How do they punish a Siamese twin if one commits murder?”
I’ll say, “Bring me a sword!” and stall for time until I think of something profound and mutter obscure Latin phrases until…until I direct them to my Emu-Faberge purse web site on the new and improved Max iPad much to the chagrin of the wonderful Mrs. Perez, Proctor and Gamble, and those seeking enlightenment.
“Lesser Sensory Perception (LSP) is the path to true happiness…still stalling…if one hears no evil, sees no evil, or feels no evil, it is only a matter of time until one disbelieves in evil. So when evil comes, one calls it ‘ungoodness.’ Which, technically speaking, is not an actual English word so one might as well re-arrange the letters to make ‘goosed nuns.’ And everybody knows a goosed nun is a rare nun albeit a definite evil.”
Fortunately, the same fellow offered me another job at Z-Tech in the Pharmaceutical Department.”
“This sounds a bit like Jakob’s Predestination.”
“Or Fate,” said Maurice. “I’m still up in the air on the whole Predestination thing. How about yourself? How did you become the lifestyle editor of the Shenandoah Valley Times?”
“Well, my story isn’t quite like yours, but here goes.
Once upon a time not long ago for people with long memories, nor far away for people with access to paved roads, I was in English class studying things that modify other things. I don't know what the things getting modified were, but I couldn’t help but think what a shallow and hollow existence the modifiers must lead knowing their sole purpose was to constantly assure nouns of their true qualities. Dangling participles, hanging gerunds, or uptight adverbs arguing over objects, both directly or indirectly, was a complete mystery such that I felt deeply disturbed by the whole situation and felt compelled to ponder it. After a particularly lonesome noun spent fifteen grueling minutes getting told how wonderful, great, shiny, tall, and querulous it was, I seriously doubted if there was any hope for the little fellow and wondered if guidance counselors felt the same way about kids with consonant-heavy surnames.
After much ponder a sort of melancholy set in. This, coupled to the fact I sat in the back of the class...on a warm sunny day...by an open window...next to a large fan...and behind a rather large classmate led me into deeper thoughts until a mild depression struck. The sort of depression one feels when you discover Santa Claus isn't quite the jolly old Scandinavian you thought and Milo and Otis aren't truly talking animals. Soon, the depression merged into a cat-nap, which in turn merged onto a human nap. And that’s when I discovered the Law of the Conservation of Entropy.”
“Which is?”
“Brains in motion tend to stay in motion, and brains at rest tend to watch hours upon hours of television.”
“And you want your brain to be…?”
“In a constant state of flux. I decided to become a writer, and rest is rapidly becoming a historically significant event in the Book of Life.”
* * *
Candy Skipper was tired. She had planned on a quiet day at work and wanted nothing dramatic, like yesterday’s Call, to impinge upon her daily plans. When she walked into her office, she was surprised to see an official of Z-Tech’s Monitoring Other’s Business section (MOB) waiting for her.
“Candy Skipper?” the man stood and stretched his hand towards her. “Lieutenant Jones from the MOB. How do you do?”
”Fine, thank you.” She didn’t offer to shake his hand. “Can I help you?”
“I’m looking for one of your co-workers-Maurice Perez. We are having some difficulty locating him and thought you might shed some light on his location.”
“Yes. Mr. Perez works here. Is he in any trouble?”
“Oh, no. Nothing of the sort,” he said. “It’s just that yesterday he didn’t go to the Hives when The Call sounded. Is he ill?”
“Not that I know of,” Candy replied. She thought the little man from the MOB a little square and just a little cute. “Did you check his apartment?”
“He’s not there and wasn’t seen last night returning. Does Mr. Perez have a girlfriend?”
“Not to my immediate knowledge. I’m sure he’d tell me if he did.”
“You are sure?”
“Quite sure.” Candy felt it quite silly that her heart skipped a beat at this last question.
“Mr. Perez and you are quite close, are you not?”
“We’re a bit more than casual acquaintances. I’m his secretary, nothing more, nothing less.”
“Is he supposed to be in today?”
“You’re asking the wrong person.” And a lot of them, she thought. “Why don’t you just stick around and wait for him yourself,” she smiled.
The little man from the MOB stared at her blankly.
“Why does the MOB want to see Mr. Perez?”
“Mr. Perez is very important right now. The Velkladdeur himself desires to see him, and I have reasons of my own.”
“Ohh, in that case. . .”
10 August 2011
27 July 2011
page 26
“Something happened at the Hives today, Polly. Have you seen the Goshenites? They’ve changed. They look like people who have spent eighteen hours watching reality television. They’ve been hypnotized somehow. I’ve noticed the same effects on the lab mice at Z-Tech.”
“Do tell me, surely you don’t make them watch reality T.V.?”
“No ma’am. We have a policy against animal cruelty. We make they’re lives as pleasant as possible, unfortunately they don’t live long under carefully regulated coddling conditions of comfort. They grow fat and sleepy and like staring at pictures of cheese.”
“What does go on at the Hives?” asked Polly.
“I think some type of population monitoring or human enhancing activities. I’ve heard the word ‘HIVES’ stand for Human Illuminated V…Enhancement S…Nobody seems to know what the ‘V’ and ‘S’ mean. My co-workers tell me it’s like a gigantic hospital and gaming amusement park. Nobody truly knows except the Perfectabilists who run the place. Some of our own scientists are rumored to be members of that secretive lot.”
“Do you like your job at Z-Tech?”
“You’re the first person to ask me. It’s fun building alien-seeking drones, but lately they’ve started to act odd.”
“It sounds as if you have some reservations and want out of the company.”
“Nobody ever really gets out from Z-Tech, Polly. It’s like the Mafia or grocery-shopping. Everybody knows you cannot enter a grocery store without making a purchase. You can't say, ‘Oh, I'm just looking,’ like you can sometimes do at 7-11 from the hours between midnight and six A.M....at least without a straight face and a mask of some sort. You’re marked for life-literally marked. They insert a microchip in your arm and track your every movement. It’s called ‘getting cained.’
“That sounds horribly punny.”
“So it is…so it is…”
“But you’re not chipped-are you?”
“No, but I do have an ID bracelet I’m authorized to wear at work that acts as the same thing."
“Do tell me, surely you don’t make them watch reality T.V.?”
“No ma’am. We have a policy against animal cruelty. We make they’re lives as pleasant as possible, unfortunately they don’t live long under carefully regulated coddling conditions of comfort. They grow fat and sleepy and like staring at pictures of cheese.”
“What does go on at the Hives?” asked Polly.
“I think some type of population monitoring or human enhancing activities. I’ve heard the word ‘HIVES’ stand for Human Illuminated V…Enhancement S…Nobody seems to know what the ‘V’ and ‘S’ mean. My co-workers tell me it’s like a gigantic hospital and gaming amusement park. Nobody truly knows except the Perfectabilists who run the place. Some of our own scientists are rumored to be members of that secretive lot.”
“Do you like your job at Z-Tech?”
“You’re the first person to ask me. It’s fun building alien-seeking drones, but lately they’ve started to act odd.”
“It sounds as if you have some reservations and want out of the company.”
“Nobody ever really gets out from Z-Tech, Polly. It’s like the Mafia or grocery-shopping. Everybody knows you cannot enter a grocery store without making a purchase. You can't say, ‘Oh, I'm just looking,’ like you can sometimes do at 7-11 from the hours between midnight and six A.M....at least without a straight face and a mask of some sort. You’re marked for life-literally marked. They insert a microchip in your arm and track your every movement. It’s called ‘getting cained.’
“That sounds horribly punny.”
“So it is…so it is…”
“But you’re not chipped-are you?”
“No, but I do have an ID bracelet I’m authorized to wear at work that acts as the same thing."
22 June 2011
Page 25
"That's very good to hear," said Maurice at the other end of the line-his cell phone really as lines of the telephone type no longer existed except in the abstract sense (as real lines do). Which goes to show you that history repeats itself, though not always in the way one imagines.
"That's the only explanation," said Polly. "Cerberus saw your shoes and his cerebral circuits said foreign shoes = alien. What are you wearing?"
"New Balance. They're made in Connecticut. That can't be true. Connecticut is practically part of the U.S. and just because we sold it to Canada...why did we sell it to Canada?"
"To make ends meet was the way I understood it, according to the official MediaCon line.
"That's the only explanation," said Polly. "Cerberus saw your shoes and his cerebral circuits said foreign shoes = alien. What are you wearing?"
"New Balance. They're made in Connecticut. That can't be true. Connecticut is practically part of the U.S. and just because we sold it to Canada...why did we sell it to Canada?"
"To make ends meet was the way I understood it, according to the official MediaCon line.
20 June 2011
Erosion
"Satan has in fact a plan against the saints of the Most High which is to wear them out. What is meant by this phrase, "wear out"? It has in it the idea of reducing a little this minute, then reducing a little further the next minute. Reduce a little today, reduce a little tomorrow. Thus the wearing out is almost imperceptible; nevertheless, it is a reducing. The wearing down is scarcely an activity of which one is conscious, yet the end result is that there is nothing left. He will take away your prayer life little by little, and cause you to trust God less and less and yourself more and more, a little at a time. He will make you feel somewhat cleverer than before. Step by step, you are misled to rely more on your own gift, and step by step your heart is enticed away from the Lord. Now, were Satan to strike the children of God with great force at one time, they would know exactly how to resist the enemy since they would immediately recognize his work. He uses the method of gradualism to wear down the people of God."
--Watchman Nee and found online at http://dailychristianquote.com/dcqnee.html
--Watchman Nee and found online at http://dailychristianquote.com/dcqnee.html
14 June 2011
Page 24
“Um…I see. Say, Polly. Do you feel good right now”
“Me? Yep- I feel physically fine. Mentally competent. Somewhat bloated from the egg nog and Mexican tossed salad, but otherwise great. I need a hair-cut and this bothers me a little…not a lot as I don’t have a boyfriend, or soul-mate, or any other kind of primate to impress right now. Emotionally…I feel stable-a little shaky at times, but that’s due to dietary influences and rising/lowering hormonal levels. I feel witty…on a scale of 1 to 10…about oh’…pi…plus or minus a percentage point. I feel smug. A little sarcastic…just enough to irritate people an hour or two from a full-blown tension headache-no more, no less. That’s pretty much how I feel right now.
Lately, I’ve been talking to myself using short declarative sentences…using the intended ‘I’ to save time. I also answer myself using the ‘you’ understood. Most often though the conversations consist of sentence fragments with lots of adjectives. I don’t think this makes for good writing though. Nor does using the word ‘though’ a lot. I read yesterday that good writers use verbs-the action ones-and leave the passive ones to the novices to keep them poor and practicing. I tell myself it’s like reading a John Steinbeck novel...someday I hope to believe it. I tell this to my friends-all of who are invisible by the way. Most of my invisible amigos speak Spanglish which I appreciate since I love Mexican food and can now read the labels in the Hispanic section of Food Lion. Once, one of my friends-from New Zealand-asked me to fetch a trolley before we entered the deli section. I stood there in complete silence for an entire minute trying to translate this into English. A kindly cashier girl- whom I was not trying to impress due to my unique hair situation-asked if I needed any help. I said, “No thank you, I’m just a little confused right now.” She nodded and gave me a shopping cart to lessen my dilemma.
I thought about dating the other night. The Aztecs were good at it and constructed elaborate carved stones showing how to do it right. “The stones are still there,” Raquel told me. “Unfortunately the Aztecs are extinct and the stones untranslatable as nobody alive now speaks Aztec.” The Aztecs caused many problems going extinct, for now, nobody knows how to date properly. Although…the Mayans say we need not worry as the world will end at precisely midnight three years and nine days from now. I wish I were attracted to Mayan men.”
“Me? Yep- I feel physically fine. Mentally competent. Somewhat bloated from the egg nog and Mexican tossed salad, but otherwise great. I need a hair-cut and this bothers me a little…not a lot as I don’t have a boyfriend, or soul-mate, or any other kind of primate to impress right now. Emotionally…I feel stable-a little shaky at times, but that’s due to dietary influences and rising/lowering hormonal levels. I feel witty…on a scale of 1 to 10…about oh’…pi…plus or minus a percentage point. I feel smug. A little sarcastic…just enough to irritate people an hour or two from a full-blown tension headache-no more, no less. That’s pretty much how I feel right now.
Lately, I’ve been talking to myself using short declarative sentences…using the intended ‘I’ to save time. I also answer myself using the ‘you’ understood. Most often though the conversations consist of sentence fragments with lots of adjectives. I don’t think this makes for good writing though. Nor does using the word ‘though’ a lot. I read yesterday that good writers use verbs-the action ones-and leave the passive ones to the novices to keep them poor and practicing. I tell myself it’s like reading a John Steinbeck novel...someday I hope to believe it. I tell this to my friends-all of who are invisible by the way. Most of my invisible amigos speak Spanglish which I appreciate since I love Mexican food and can now read the labels in the Hispanic section of Food Lion. Once, one of my friends-from New Zealand-asked me to fetch a trolley before we entered the deli section. I stood there in complete silence for an entire minute trying to translate this into English. A kindly cashier girl- whom I was not trying to impress due to my unique hair situation-asked if I needed any help. I said, “No thank you, I’m just a little confused right now.” She nodded and gave me a shopping cart to lessen my dilemma.
I thought about dating the other night. The Aztecs were good at it and constructed elaborate carved stones showing how to do it right. “The stones are still there,” Raquel told me. “Unfortunately the Aztecs are extinct and the stones untranslatable as nobody alive now speaks Aztec.” The Aztecs caused many problems going extinct, for now, nobody knows how to date properly. Although…the Mayans say we need not worry as the world will end at precisely midnight three years and nine days from now. I wish I were attracted to Mayan men.”
Page 23 (OK, so it's been awhile)
“Polly. It’s me. I’ve been shot, tracked, and drone-handled. Are you busy?”
“I’m reviewing a new eatery in Canaan called ‘Just Desserts.’ It’s run by the local prison. I’ve heard it’s more profitable than making license plates. Is everything OK?”
“Except for the drone-handling by Cerberus I…yes.”
“Oh dear,” said Polly. “Are you sure you aren’t an alien?”
“Never have been, nor ever will be. All I can figure is the drone mistook me for somebody else…the Can man…ever here of him?”
“A dear old chap. Yes, I remember him. Malachi and I nearly ran over him once or twice…certainly no more than three times…and definitely not more than four.”
“Well Cerberus just shocked the Can man into the next world. The drone must have assumed he was a looter when he was found walking about the Plaza. You do know there was a Call for all Goshenites to drop everything and go to the Hives this morning?”
Polly assumed a pensive look that most people make before ordering something in French with hopes it is not a member of the mollusk family or has or use to have tentacles. It was a beast of a time, it was two at the time, and she said nothing but stare at her soles.
A wave of intuition hit Polly.
“Cerberus likes your shoes. All dogs do…even mechanical flying hounds programmed with algorithms by evil men and the Differentia.”
* (ed. Note) The Differentia was a class of scientists in the city-state of Goshen formerly known as Nerds
“I’m reviewing a new eatery in Canaan called ‘Just Desserts.’ It’s run by the local prison. I’ve heard it’s more profitable than making license plates. Is everything OK?”
“Except for the drone-handling by Cerberus I…yes.”
“Oh dear,” said Polly. “Are you sure you aren’t an alien?”
“Never have been, nor ever will be. All I can figure is the drone mistook me for somebody else…the Can man…ever here of him?”
“A dear old chap. Yes, I remember him. Malachi and I nearly ran over him once or twice…certainly no more than three times…and definitely not more than four.”
“Well Cerberus just shocked the Can man into the next world. The drone must have assumed he was a looter when he was found walking about the Plaza. You do know there was a Call for all Goshenites to drop everything and go to the Hives this morning?”
Polly assumed a pensive look that most people make before ordering something in French with hopes it is not a member of the mollusk family or has or use to have tentacles. It was a beast of a time, it was two at the time, and she said nothing but stare at her soles.
A wave of intuition hit Polly.
“Cerberus likes your shoes. All dogs do…even mechanical flying hounds programmed with algorithms by evil men and the Differentia.”
* (ed. Note) The Differentia was a class of scientists in the city-state of Goshen formerly known as Nerds
30 May 2011
Light travels
The older I get the more I think the Earth was seeded by people from another part of the galaxy and that God is really a gigantic computer programmer who has engineered the planet almost like its an enormous computer game. We are, in relation to God, like cartoon characters who will one day leave our body of atoms and molecules, get downloaded into a more complex set of sub-atomic particles...we'll call them tachyons since they have as one of their intrinsic properties the ability to move faster than the speed of light (hence are not subject to the sspace/time continuum)...and live forever in bodies that are luminescent.
16 May 2011
Page 22
Lieutenant Jones hung up the phone, grabbed a color-coded pen that said, expiration date 5 Nov 2047, and stared at the monitor watching the Plaza. He placed the stylus over a young brunette and clicked. A window appeared onscreen:
Date: 23 Oct 2047
Age: 25
Gender: Female
►more
He clicked ‘more.’ Her family’s closest relatives came up.
Another tap of the stylus.
The screen magnified her image. He zoomed in on her left hand and frowned when he saw the diamond. ‘Strange how some people refused to abandon old traditions.’
Tap…tap…went the stylus as magnification returned to normal. A bearded man caught his attention. Tap…tap…the window revealed little information.
Date: 23 Oct 2047
Approx age: 33
Gender: male
ID: unknown
Unchipper. A call to Central and he would be marked. Lieutenant Jones leaned back in his floating chair and saved the unchipper link to his hard drive, then e-mailed the link to Central. Onscreen, he watched as two Sweep Patrollers immobilized the bearded man with tranquilizers. Nobody asked any questions, nor did they care.
Cash-only transactions in Goshen were almost unheard of nowadays. It would be like paying for goods with gold dust in the early 21st-century. Cash attracted attention to yourself, Sweep Patrollers, Cerberus drones, and (oddly enough) those strange simian-like creatures who wandered the city-state in ever-increasing numbers. Cash labeled you an individual…a solitaire.
Solitaires, while not expressly forbidden, were discouraged and every attempt was made to discourage individualism. Individuals didn’t think like the whole and discouraged unity. Free-thinkers were dangerous.
Four hours of people-monitoring the Plaza wearied Jones. He walked down to the Reality Room, put on his infrared goggles and opened the door to a darkened room. He walked down rows of cubicles seeing people laying on gamer cots with closed eyes and wearing neuroscopes. They were in cybersleep.
Jones settled into the black padded foam chair and adjusted the neuroscopes. He slid his hands into the attached gloves. Almost instantly, the computer read his implanted verichip which identified him as 66-543-8A. A retinal scan confirmed his ID number.
He found himself walking on Madburg Ave in the heart of the club district. He entered St. Bucks CafĂ© and Blues. A holographic Elvis and Michael Jackson were singing the duet ‘Love Me Tender, whether I’m Black or White.’ He put a quarter in the juke box (he had an infinite supply of these and never asked why). A blond-haired girl with tattoos covering her arms sang about satellites falling from the sky…watch yourself and death defy.
“So true,” said a weepy-eyed girl beside him. Jones nodded absently. She was a cute girl with nary a single blemish on her pixilated face.
“Did you hear about the latest satellite fall?” asked Jones. “It landed on top of Logan’s Castle.”
She giggled. “Serves him right after closing the water park a month early. Anyone hurt?”
“Nope. Nobody home except Logan himself and some unchippers.”
Five hours later, Jones emerged from cybersleep and returned to work, realized he was done for the day, had 29 more days until the Sucralose and methyl butyrate kicked in, then went home to a night of Lifequility. He found it difficult to differentiate between the virtual and actual world…but then didn’t everybody?
Date: 23 Oct 2047
Age: 25
Gender: Female
►more
He clicked ‘more.’ Her family’s closest relatives came up.
Another tap of the stylus.
The screen magnified her image. He zoomed in on her left hand and frowned when he saw the diamond. ‘Strange how some people refused to abandon old traditions.’
Tap…tap…went the stylus as magnification returned to normal. A bearded man caught his attention. Tap…tap…the window revealed little information.
Date: 23 Oct 2047
Approx age: 33
Gender: male
ID: unknown
Unchipper. A call to Central and he would be marked. Lieutenant Jones leaned back in his floating chair and saved the unchipper link to his hard drive, then e-mailed the link to Central. Onscreen, he watched as two Sweep Patrollers immobilized the bearded man with tranquilizers. Nobody asked any questions, nor did they care.
Cash-only transactions in Goshen were almost unheard of nowadays. It would be like paying for goods with gold dust in the early 21st-century. Cash attracted attention to yourself, Sweep Patrollers, Cerberus drones, and (oddly enough) those strange simian-like creatures who wandered the city-state in ever-increasing numbers. Cash labeled you an individual…a solitaire.
Solitaires, while not expressly forbidden, were discouraged and every attempt was made to discourage individualism. Individuals didn’t think like the whole and discouraged unity. Free-thinkers were dangerous.
Four hours of people-monitoring the Plaza wearied Jones. He walked down to the Reality Room, put on his infrared goggles and opened the door to a darkened room. He walked down rows of cubicles seeing people laying on gamer cots with closed eyes and wearing neuroscopes. They were in cybersleep.
Jones settled into the black padded foam chair and adjusted the neuroscopes. He slid his hands into the attached gloves. Almost instantly, the computer read his implanted verichip which identified him as 66-543-8A. A retinal scan confirmed his ID number.
He found himself walking on Madburg Ave in the heart of the club district. He entered St. Bucks CafĂ© and Blues. A holographic Elvis and Michael Jackson were singing the duet ‘Love Me Tender, whether I’m Black or White.’ He put a quarter in the juke box (he had an infinite supply of these and never asked why). A blond-haired girl with tattoos covering her arms sang about satellites falling from the sky…watch yourself and death defy.
“So true,” said a weepy-eyed girl beside him. Jones nodded absently. She was a cute girl with nary a single blemish on her pixilated face.
“Did you hear about the latest satellite fall?” asked Jones. “It landed on top of Logan’s Castle.”
She giggled. “Serves him right after closing the water park a month early. Anyone hurt?”
“Nope. Nobody home except Logan himself and some unchippers.”
Five hours later, Jones emerged from cybersleep and returned to work, realized he was done for the day, had 29 more days until the Sucralose and methyl butyrate kicked in, then went home to a night of Lifequility. He found it difficult to differentiate between the virtual and actual world…but then didn’t everybody?
09 May 2011
Page 21
Lieutenant Jones was 48-years-old and looked 30. He had never been sick a day in his life, and never passed up the opportunity to say so. He loved being in control. Every day he rose at precisely 5:30 AM and immediately started the coffee maker. Then he drank 8 ounces of water chilled to exactly 40 degrees F. At 6:00 AM, he drank the coffee, ate breakfast, brushed his teeth, used the bathroom, dressed for work, and checked off everything he’d done so far on a list.
He also loved lists, especially the making of and checking off parts. When he did something that was not on a list, he added it to the list and checked it off. At the end of every day he collected all the lists and added them to The List…an on-going database that detailed his life’s history to such exquisite detail that he planned on bequeathing it to Maurice’s next door neighbor as a torture device should the need ever arise.
He departed his townhouse at 6:35 AM. 6:50 AM found him parking in spot 5A of the Z-Tech parking lot and 6:59 AM found him primed, prepped, and prepared for people-monitoring, power-mongering, and list-making activities.
Lieutenant Jones puzzled over how the man escaped. ‘What kind of electrical disturbance could cause the drone to break down?’ He wondered if the Velkladdaur knew he hadn’t quite told the truth in the matter. Truthfully, it had to be an electrical disturbance. There was no other explanation.
30 days.
* * *
“We downloaded the video and see the unchipper in the plaza,” explained Quinton Verbosity, Jones’ lead programmer. “The best we can figure out is the tramp stood directly in the line of sight between the drone and Mr. No-chip while the video was running…sort of like the moon during a solar eclipse. See right here at 17’00”35.6…and then as we go to 17’00”42.7.”
Here the technician fast-forwarded the downloaded video.
“Here we see the plaza empty except for these two.”
“You didn’t get a video of the unchipper’s face?”
“Nope. Strangest thing. All the video shows is the back of his head. When he turned around facing the camera, there either was somebody directly in front of him, or else the video just went blank. It’s prolly just an electrical surge in the wiring induced by the latest Call.”
Jones put his face in his hands, and then said. “Get me a picture of the unchipper anyways. The best you can come up with…a close-up. I want to see what the man was wearing. What brand of watch he wears. His hairstyle. I want to know know the cologne type on his skin. Whether he was sunburnt on this day. Things…things I can put on a list and analyze and ponder. The Velkladdeur seems to think it important to find this guy.”
The technician whistled. “What for?”
“Not certain. But know this. When the Velkladdeur wants his man, that man has something worth taking.”
* * *
“Here you go Lieutenant” The technician laid a digitally-enhanced photo on Jones’ desk. “Abercrombie and Fitch khaki pants and looks like size 32-34 waist. Light blue long-sleeved shirt with partially rolled-up sleeves. The shoes appear to be size 11 black Adidas hiking boots.”
“Thank you. That only narrows it down to about…3,000 different people in this city.”
Lieutenant Jones stared at the picture. The digitally-enhanced photo reminded him of one of the scientists in the other drone-making divisions. Tap…tap…tap…went his fingers.
‘Maurice. That’s his name.’
He called the secretary’s office at the alien-tracking division and got a Ms. Skipper.
“Nope. Sorry Mr. Jones. Maurice isn’t working today.”
He also loved lists, especially the making of and checking off parts. When he did something that was not on a list, he added it to the list and checked it off. At the end of every day he collected all the lists and added them to The List…an on-going database that detailed his life’s history to such exquisite detail that he planned on bequeathing it to Maurice’s next door neighbor as a torture device should the need ever arise.
He departed his townhouse at 6:35 AM. 6:50 AM found him parking in spot 5A of the Z-Tech parking lot and 6:59 AM found him primed, prepped, and prepared for people-monitoring, power-mongering, and list-making activities.
Lieutenant Jones puzzled over how the man escaped. ‘What kind of electrical disturbance could cause the drone to break down?’ He wondered if the Velkladdaur knew he hadn’t quite told the truth in the matter. Truthfully, it had to be an electrical disturbance. There was no other explanation.
30 days.
* * *
“We downloaded the video and see the unchipper in the plaza,” explained Quinton Verbosity, Jones’ lead programmer. “The best we can figure out is the tramp stood directly in the line of sight between the drone and Mr. No-chip while the video was running…sort of like the moon during a solar eclipse. See right here at 17’00”35.6…and then as we go to 17’00”42.7.”
Here the technician fast-forwarded the downloaded video.
“Here we see the plaza empty except for these two.”
“You didn’t get a video of the unchipper’s face?”
“Nope. Strangest thing. All the video shows is the back of his head. When he turned around facing the camera, there either was somebody directly in front of him, or else the video just went blank. It’s prolly just an electrical surge in the wiring induced by the latest Call.”
Jones put his face in his hands, and then said. “Get me a picture of the unchipper anyways. The best you can come up with…a close-up. I want to see what the man was wearing. What brand of watch he wears. His hairstyle. I want to know know the cologne type on his skin. Whether he was sunburnt on this day. Things…things I can put on a list and analyze and ponder. The Velkladdeur seems to think it important to find this guy.”
The technician whistled. “What for?”
“Not certain. But know this. When the Velkladdeur wants his man, that man has something worth taking.”
* * *
“Here you go Lieutenant” The technician laid a digitally-enhanced photo on Jones’ desk. “Abercrombie and Fitch khaki pants and looks like size 32-34 waist. Light blue long-sleeved shirt with partially rolled-up sleeves. The shoes appear to be size 11 black Adidas hiking boots.”
“Thank you. That only narrows it down to about…3,000 different people in this city.”
Lieutenant Jones stared at the picture. The digitally-enhanced photo reminded him of one of the scientists in the other drone-making divisions. Tap…tap…tap…went his fingers.
‘Maurice. That’s his name.’
He called the secretary’s office at the alien-tracking division and got a Ms. Skipper.
“Nope. Sorry Mr. Jones. Maurice isn’t working today.”
28 April 2011
Page 20
(Later that afternoon in an unmarked lab, behind an unlabeled door, in a secret hideaway, stood a mysterious scientist whose last name was Jones. His first name was Lieutenant, but nobody except the VelkLaddeur, the National Security Agency, the VISA credit card company, and the payroll secretary knew this. Across an enormous ebony desk sat the VelkLaddeur himself…an even more mysterious gentleman who used no other name than ‘VelkLaddeur.’)
“You lost him?” asked the VelkLaddeur.
“No, Sir. We got him, but somehow he escaped,” said Lieutenant Jones.
“What do you mean ‘you got him.’ If you got him, he would be dead.”
“Yes, Sir. But you see, when we sent in the corpse collection unit, all they found was an old man named Maximus Dudley.”
“Didn’t Cerberus I see the unchipper in the plaza?”
“That they did, Sir. But there was some kind of electrical disturbance that confused Cerberus’s circuitry. The unchipper must have escaped then. The most likely explanation is the drone…once the electrical disturbance ceased…automatically assumed Mr. Dudley was the unchipped man.”
“Maximus Dudley was a chipped man Lieutenant. How could the drone assume otherwise? Machines never assume Lieutenant. Never. What kind of electrical disturbance was this?”
“We’re still uncertain. Our tech guys are checking it out as we speak. Nothing’s turned up yet. It seems in perfect working order.”
“Keep looking Lieutenant. And keep looking until you find the problem. The last thing we need is another unchipped cowboy running around footloose and fancy free.”
“Yes, Sir.”
“I want a full report of the problem ASAP.”
“Yes, Sir.”
“One more thing. See the safe nurse before you leave.”
“But, Sir.”
“You know the Law Codes. Eye for eye and tooth for tooth.”
“What if we don’t find him?”
“Thirty days Lieutenant. You have thirty days before the methyl butyrate is released.”
Lieutenant Jones left the VelkLaddeur’s office. The last thing he saw was his Cheshire cat-like grin. It unnerved him.
Lieutenant Jones grumbled to himself as he walked the long corridor to the safe nurse’s lab. He hated this building. Every conversation was under constant surveillance, 24 hours a day, seven days a week. One couldn’t even grumble aloud without it going on record. Secretly, he was glad when it was quitting time. Working for Z-Tech gave one a headache. One couldn’t even go to the bathroom without some roving mechanical Cyclops staring at you. Yet, this was the case for all government buildings…constant surveillance…always watching.
Lieutenant Jones entered the safe nurse lab where he instinctively held out his hand and passed it over the receptionist’s scanner. It beeped.
“We’ve been expecting you,” said a thin, middle-aged woman with short hair, plain face, who could easily have passed for a man. Her name tag said Leah. “Dr. Charan will see you now.”
She led him to a small room with pink walls and told him to sit on a table. Leah closed the door and left. He tried the door. Locked. The room was bare. No cabinets, tables, or anything to suggest he was in a doctor’s office, yet he knew he was monitored. A moment later the door opened.
Dr. Ali Singhe Charan was short, bald, possessed bushy gray eyebrows, and a wrinkly forehead. “You know how this works,” said Dr. Charan immediately. “Same principle as the V-chip in your right arm. This will be in your left arm. Roll up your sleeves.”
Jones rolled up his left sleeve and relaxed as Dr. Charan rubbed alcohol on his arm. Then he picked up a needle, inserted a rice-sized capsule, and carefully injected it in Jones' arm.
That’s it?” he asked.
“Yes,” replied Dr. Charan. “In 30 days the capsule is programmed to release 100 micrograms of methyl butyrate and 50 micrograms of Sucralose. First you fall asleep, then the heart stops beating. So quick, easy, and painless.”
“And the antidote?”
“There is no antidote for the red capsule. We remove it manually.”
Lieutenant Jones forced a grin. “I feel like Damocles.”
“You are Damocles,” said Dr. Charan.
“You lost him?” asked the VelkLaddeur.
“No, Sir. We got him, but somehow he escaped,” said Lieutenant Jones.
“What do you mean ‘you got him.’ If you got him, he would be dead.”
“Yes, Sir. But you see, when we sent in the corpse collection unit, all they found was an old man named Maximus Dudley.”
“Didn’t Cerberus I see the unchipper in the plaza?”
“That they did, Sir. But there was some kind of electrical disturbance that confused Cerberus’s circuitry. The unchipper must have escaped then. The most likely explanation is the drone…once the electrical disturbance ceased…automatically assumed Mr. Dudley was the unchipped man.”
“Maximus Dudley was a chipped man Lieutenant. How could the drone assume otherwise? Machines never assume Lieutenant. Never. What kind of electrical disturbance was this?”
“We’re still uncertain. Our tech guys are checking it out as we speak. Nothing’s turned up yet. It seems in perfect working order.”
“Keep looking Lieutenant. And keep looking until you find the problem. The last thing we need is another unchipped cowboy running around footloose and fancy free.”
“Yes, Sir.”
“I want a full report of the problem ASAP.”
“Yes, Sir.”
“One more thing. See the safe nurse before you leave.”
“But, Sir.”
“You know the Law Codes. Eye for eye and tooth for tooth.”
“What if we don’t find him?”
“Thirty days Lieutenant. You have thirty days before the methyl butyrate is released.”
Lieutenant Jones left the VelkLaddeur’s office. The last thing he saw was his Cheshire cat-like grin. It unnerved him.
Lieutenant Jones grumbled to himself as he walked the long corridor to the safe nurse’s lab. He hated this building. Every conversation was under constant surveillance, 24 hours a day, seven days a week. One couldn’t even grumble aloud without it going on record. Secretly, he was glad when it was quitting time. Working for Z-Tech gave one a headache. One couldn’t even go to the bathroom without some roving mechanical Cyclops staring at you. Yet, this was the case for all government buildings…constant surveillance…always watching.
Lieutenant Jones entered the safe nurse lab where he instinctively held out his hand and passed it over the receptionist’s scanner. It beeped.
“We’ve been expecting you,” said a thin, middle-aged woman with short hair, plain face, who could easily have passed for a man. Her name tag said Leah. “Dr. Charan will see you now.”
She led him to a small room with pink walls and told him to sit on a table. Leah closed the door and left. He tried the door. Locked. The room was bare. No cabinets, tables, or anything to suggest he was in a doctor’s office, yet he knew he was monitored. A moment later the door opened.
Dr. Ali Singhe Charan was short, bald, possessed bushy gray eyebrows, and a wrinkly forehead. “You know how this works,” said Dr. Charan immediately. “Same principle as the V-chip in your right arm. This will be in your left arm. Roll up your sleeves.”
Jones rolled up his left sleeve and relaxed as Dr. Charan rubbed alcohol on his arm. Then he picked up a needle, inserted a rice-sized capsule, and carefully injected it in Jones' arm.
That’s it?” he asked.
“Yes,” replied Dr. Charan. “In 30 days the capsule is programmed to release 100 micrograms of methyl butyrate and 50 micrograms of Sucralose. First you fall asleep, then the heart stops beating. So quick, easy, and painless.”
“And the antidote?”
“There is no antidote for the red capsule. We remove it manually.”
Lieutenant Jones forced a grin. “I feel like Damocles.”
“You are Damocles,” said Dr. Charan.
27 April 2011
Page 19
He sensed the drone scrape cells from his skin. Just a few were needed for a complete DNA analysis. Out of the corner of his eye he read the name ‘Z-Tech Cerberus I’ painted on the drone’s metallic underbelly. Maurice closed his eyes and willed himself into something like a trance. As a scientist working in the industrial section of Z-Tech, he knew the machine was analyzing his skin cells and when it discovered he was not at the Hive Complex…or at work, he stood a very good chance of being zapped with an uncommonly large voltage usually reserved for the undesirable classes.
He could tell by the beeps and whistles sounding from Cerberus I that the initial results were calculated.
Heart rate: 80 bpm
Blood type: O+
Height: 1.98 m
Weight: 51.1 kg
ID Number: 63MX4R_hss
“Why did the drone register me as 63MX4R_hss?” he thought. He had never been chipped before. Z-Tech kept prodding him to do so, but something about the process bothered him.
He felt the sensor remove from his body and recoil back to the drone. It flew away. Maurice relaxed.
Sometime later he heard voices on the plaza. He rolled over and gasped. The Can Man was lying beside him. His eyes stared directly into Maurice. A thin mucus covered them.
The Can man was dead.
Maurice rolled away and emptied his stomach. A minute later he left the tarp in time to see the first people emerge from the Hive Complex. “Something is different about them,” he wondered. “Their eyes. . .they’re glazy…hollow…lifeless.”
He could tell by the beeps and whistles sounding from Cerberus I that the initial results were calculated.
Heart rate: 80 bpm
Blood type: O+
Height: 1.98 m
Weight: 51.1 kg
ID Number: 63MX4R_hss
“Why did the drone register me as 63MX4R_hss?” he thought. He had never been chipped before. Z-Tech kept prodding him to do so, but something about the process bothered him.
He felt the sensor remove from his body and recoil back to the drone. It flew away. Maurice relaxed.
Sometime later he heard voices on the plaza. He rolled over and gasped. The Can Man was lying beside him. His eyes stared directly into Maurice. A thin mucus covered them.
The Can man was dead.
Maurice rolled away and emptied his stomach. A minute later he left the tarp in time to see the first people emerge from the Hive Complex. “Something is different about them,” he wondered. “Their eyes. . .they’re glazy…hollow…lifeless.”
20 April 2011
The Maine Character
For those of you who are interested.
All these posts that begin with (Page 18, page 16, Page...) can be found, read, and perhaps even commented on at my latest groovy and wonderful blog called The Maine Character.
All these posts that begin with (Page 18, page 16, Page...) can be found, read, and perhaps even commented on at my latest groovy and wonderful blog called The Maine Character.
19 April 2011
Page 18
A high-pitched wailing cry pierced the air. Maurice inhaled deeply and felt a thrill run throughout his body.
Instinctively, people everywhere in the plaza emptied their pockets of everything-receipts, credit cards, pens, watches, necklaces, even cash, and immediately laid it down. He hesitated, even though he knew this would be classified as unusual behavior. They would scan him, and later…what would they do? Take him to the Sweep Patrols? What was there to hide? Surveillance cameras covered over 98% of Goshen. Still, he hesitated, thought better, and pulled out a wad of cash and a handkerchief, and shoved it in a crack in the nearby concrete wall.
“Of all the times for the Call-it had to be now,” he thought. “I should have known better than to take a stroll through the plaza.” Most took taxis, but he liked wandering the plaza’s cobble-stoned streets with their quaint little shops-careful not to buy anything lest he arouse the Sweep-Patrols.
The countenance of everyone had changed at this latest Call. Everybody looked like hippies in a drug-induced stupor. . .hypnotized. And they all proceeded methodically towards the Hives. He felt ridiculous leaving his money out for the entire world to see. But everyone knew the Law and the Sweep Patrols were always more than happy to remind you.
“I don’t care what anyone thinks. I’m not going to the Hives.”
In short time the plaza was nearly deserted. A few stragglers hurried past, but other than that, nobody remained. The many shops surrounded the brick-lined square remained open but empty. He walked in the opposite direction from the Hive complex keeping his head down to avoid suspicion. Not everyone, he noticed, headed towards the Hives.
Maurice picked up his pace, and came to a deserted street. He felt the Presence. It was the same Presence he felt during his dream about the great stone giant in his dream. This time he knew its name.
“Velkladdeur is coming. He’s at the end of the street.”
Maurice’s uncanny intuition dramatically increased at the siren’s call. He felt Velkladdeur, the chief of the Prime Minister’s secret police, approaching in his mind's eye.
His hair stood on end. His skin crawled. He turned and walked back towards the shopping plaza.
The plaza was empty. A wave of nausea hit him. He gulped and ran towards the only door left open. Too late. It snapped shut.
“This is not good,” he thought. “Hide. I must hide.”
Out of the corner of his eye he saw a tarp-covered park bench adjacent to a construction site. Velkladdeur’s presence was gone, but something else approached. Drone. A flying Z-Tech globe that detected motion. A flying machine, basketball-sized, that sensed the smell of blood. He felt the flying droid hovering around the corner. He turned towards the tarp and nearly ran into a homeless man-the Can Man.
The Can Man was a balding fellow with short, curly, greasy, brown hair. You smelled him before you saw him. The Can Man was recognized by his clothes, since he always wore the same thing; faded blue-jeans, tee-shirt, and faded denim jacket-even in the middle of summer. People said he had a wardrobe full of identical outfits, sort of like a regular Ernest P. Worrell of whom he bore a slight resemblance. The Can Man walked around the city with a black garbage bag collecting aluminum cans to get insulin money for his diabetic wife. There was a slightly devious look in his eyes. Not enough to commit a big crime like murder, but perhaps a pickpocket or two.
Maurice glared at him and then grinned.
“Sorry,” said the Can Man in his soft timid voice. Maurice ran on.
He dropped to the ground and rolled under the tarp. Seconds later the drone rounded the corner and hovered over the very spot Maurice stood. It paused for a moment as if sniffing the air, and then silently buzzed through the air zigzagging to detect the subtle change in the air temperature. It hovered above the tarp-covered picnic table. Maurice froze. The flying drones, some no bigger than a sparrow, detected humans by heat and movement. Lay perfectly still and there was a chance one could avoid detection.
“Steady. . .steady, Maurice,” he told himself. “Don’t move.”
Every muscle in his body relaxed. He could feel the faint metallic clicking of the man-hunter probe slowly ejecting from the drone.
He sensed rather than felt the tip of the long, snaky probe rest against the back of his neck. He wasn’t sure if the probe registered his existence or not. An alternate thought struck him.
“It thinks Mr. Can is me.”
Instinctively, people everywhere in the plaza emptied their pockets of everything-receipts, credit cards, pens, watches, necklaces, even cash, and immediately laid it down. He hesitated, even though he knew this would be classified as unusual behavior. They would scan him, and later…what would they do? Take him to the Sweep Patrols? What was there to hide? Surveillance cameras covered over 98% of Goshen. Still, he hesitated, thought better, and pulled out a wad of cash and a handkerchief, and shoved it in a crack in the nearby concrete wall.
“Of all the times for the Call-it had to be now,” he thought. “I should have known better than to take a stroll through the plaza.” Most took taxis, but he liked wandering the plaza’s cobble-stoned streets with their quaint little shops-careful not to buy anything lest he arouse the Sweep-Patrols.
The countenance of everyone had changed at this latest Call. Everybody looked like hippies in a drug-induced stupor. . .hypnotized. And they all proceeded methodically towards the Hives. He felt ridiculous leaving his money out for the entire world to see. But everyone knew the Law and the Sweep Patrols were always more than happy to remind you.
“I don’t care what anyone thinks. I’m not going to the Hives.”
In short time the plaza was nearly deserted. A few stragglers hurried past, but other than that, nobody remained. The many shops surrounded the brick-lined square remained open but empty. He walked in the opposite direction from the Hive complex keeping his head down to avoid suspicion. Not everyone, he noticed, headed towards the Hives.
Maurice picked up his pace, and came to a deserted street. He felt the Presence. It was the same Presence he felt during his dream about the great stone giant in his dream. This time he knew its name.
“Velkladdeur is coming. He’s at the end of the street.”
Maurice’s uncanny intuition dramatically increased at the siren’s call. He felt Velkladdeur, the chief of the Prime Minister’s secret police, approaching in his mind's eye.
His hair stood on end. His skin crawled. He turned and walked back towards the shopping plaza.
The plaza was empty. A wave of nausea hit him. He gulped and ran towards the only door left open. Too late. It snapped shut.
“This is not good,” he thought. “Hide. I must hide.”
Out of the corner of his eye he saw a tarp-covered park bench adjacent to a construction site. Velkladdeur’s presence was gone, but something else approached. Drone. A flying Z-Tech globe that detected motion. A flying machine, basketball-sized, that sensed the smell of blood. He felt the flying droid hovering around the corner. He turned towards the tarp and nearly ran into a homeless man-the Can Man.
The Can Man was a balding fellow with short, curly, greasy, brown hair. You smelled him before you saw him. The Can Man was recognized by his clothes, since he always wore the same thing; faded blue-jeans, tee-shirt, and faded denim jacket-even in the middle of summer. People said he had a wardrobe full of identical outfits, sort of like a regular Ernest P. Worrell of whom he bore a slight resemblance. The Can Man walked around the city with a black garbage bag collecting aluminum cans to get insulin money for his diabetic wife. There was a slightly devious look in his eyes. Not enough to commit a big crime like murder, but perhaps a pickpocket or two.
Maurice glared at him and then grinned.
“Sorry,” said the Can Man in his soft timid voice. Maurice ran on.
He dropped to the ground and rolled under the tarp. Seconds later the drone rounded the corner and hovered over the very spot Maurice stood. It paused for a moment as if sniffing the air, and then silently buzzed through the air zigzagging to detect the subtle change in the air temperature. It hovered above the tarp-covered picnic table. Maurice froze. The flying drones, some no bigger than a sparrow, detected humans by heat and movement. Lay perfectly still and there was a chance one could avoid detection.
“Steady. . .steady, Maurice,” he told himself. “Don’t move.”
Every muscle in his body relaxed. He could feel the faint metallic clicking of the man-hunter probe slowly ejecting from the drone.
He sensed rather than felt the tip of the long, snaky probe rest against the back of his neck. He wasn’t sure if the probe registered his existence or not. An alternate thought struck him.
“It thinks Mr. Can is me.”
18 April 2011
Page 17
A change was coming. A most large change that would alter Goshen for a thousand years. He felt it in his blood, sensed it with his intuition, and dreamed about it.
The Call. The Call which brought change. A new beginning, a new chapter, a new type of life in Goshen. He remembered three such Calls and knew beforehand they were coming. This next one would be more profound than the previous three combined. He narrowed his eyes and averted his vision. Maurice’s intuition had grown since the third Call-now 5-years-ago.
The first Call, he barely remembered as he was 2-years old at the time, saw the building of the walls around his hometown of Bethel, Maine. The walls separated the techno city from the radioactive wasteland surrounded the now city-state. “It was chaos then,” said the old-timers and Mediacon. Many people were sick and deformed from the War of All Nations (WOAN), yet were allowed to go on living…until the second Call.
Then, the Hives were built. All city-states had them. It was around this time Maurice moved with his family to Goshen, VA. His grand-parents were one of the first to go medical cleansing. Sometime later the mal-formed were eradicated, though a remnant escaped to the scarred lands and gave rise to the Nekton. Laws were passed requiring mandatory euthanasia for those above 70-years-old and couples with undesirable genetic markers were given contraceptives. Contraceptives were eventually put into the food supply so that only Type IIA Goshenites could reproduce.
The Call. The Call which brought change. A new beginning, a new chapter, a new type of life in Goshen. He remembered three such Calls and knew beforehand they were coming. This next one would be more profound than the previous three combined. He narrowed his eyes and averted his vision. Maurice’s intuition had grown since the third Call-now 5-years-ago.
The first Call, he barely remembered as he was 2-years old at the time, saw the building of the walls around his hometown of Bethel, Maine. The walls separated the techno city from the radioactive wasteland surrounded the now city-state. “It was chaos then,” said the old-timers and Mediacon. Many people were sick and deformed from the War of All Nations (WOAN), yet were allowed to go on living…until the second Call.
Then, the Hives were built. All city-states had them. It was around this time Maurice moved with his family to Goshen, VA. His grand-parents were one of the first to go medical cleansing. Sometime later the mal-formed were eradicated, though a remnant escaped to the scarred lands and gave rise to the Nekton. Laws were passed requiring mandatory euthanasia for those above 70-years-old and couples with undesirable genetic markers were given contraceptives. Contraceptives were eventually put into the food supply so that only Type IIA Goshenites could reproduce.
17 April 2011
Quote
All good stories are inspired by homesickness, lovesickness, and an intense melancholia caused by a longing for the unseen.
11 April 2011
Page 16 (The Saga Continueth)
Maurice simply stared at the man. Then, on a whim, decided to take the day off.
He re-entered Goshen Station, boarded the same mag-lev train, and sat down by a perky blond girl that was evidently enjoying a private rock concert of her very own if her gyrations were any indication. Maurice tried to avoid her and pretended to read a newspaper he’d found in the station lobby. After a minute or so, the perky blond took out her com-tel.
“You don’t look so chipper,” she perked “Take some Lifequil.”
“I’m fine, really.”
“You don’t look so happy,” she sighed. “You should look happy.”
“Are you happy?” he asked.
“What kinda’ question is that? You’re not weird are ya’?”
“No ma’am. I’m a biological researcher at Z-Tech Pharmaceutical, Industrial, and Culinary Consultants. We have a policy against weirdness…it’s in the SOP.”
(ed. note) This is actually true…Weirdness, oddness, introversion, avid book reading, religious activities, woodworking, non-tv watching, and uniqueness-in-general were frowned upon and documented in the official employee handbook under a chapter called ‘Deviant Employee Behavior and what to do about it.’
"Lifequil doesn’t make me happy-it makes me hyper. There’s a difference you know.”
“Oh my Gaia, you ARE weird,” she frowned. “I’ll tell the Controllers about you. HAL will make you happy. HAL makes everybody happy.”
The blond stared at Maurice for a full twenty seconds blankly then re-inserted her com-tel. Somewhere, someplace this conversation was being recorded…if not watched, and the words automatically sent to HAL for a keyword scan. He felt sure the conversation would pass the alerts. Maurice had a knack for carefully monitoring his conversation. Lately, there had been reports of increased crackdowns of possible terrorists and HAL had been busier than usual. He wasn’t sure if there were more terrorists or not. The media said there was, so it must be true, he thought. Or was it? In truth, he wasn’t sure about anything seen on the media anymore. Some of it seemed too far-fetched to be believed. Mediacon said the population of Gaia was holding steady at 6.6 billion, the optimum carrying-capacity of the planet. He figured this was about right. Goshen’s population was 300,000, average for a city-state, and one of 2,200 such places in the merry ole’ Virginia Commonwealth. The population of the Badlanders and Nekton was unknown. Everyone was happy, and healthy, and safe. The pre-ill were carefully monitored and at the first sign of illness, sent to the Hives for treatment. Need a new liver? The Hives could make you one.
The train lurched to a halt. The blond girl put a packet of Lifequil in his hand.
“Take these. Please. They’ll do a body good.”
Maurice nodded, “Thanks…”
“You’ve got to get in the groove, man. Get with it. You gotta’ be running high.” She smiled.
He put the pills in his pocket and walked the half-block back to his apartment under the watchful eyes of countless probes. He felt a twinge of sadness, not a good sign, and blamed it on being pre-ill. Soon, he would hear The Call and make his way to the Hives for medical testing.
"Thank HAL it’s not today,” he thought.
Maurice’s last visit to the Hives was 3-years-ago. He passed the med-alerts with flying colors. Sure, he had a genetic predisposition to melancholia, solitude, and obsessive-compulsive-reading disorder, but Lifequil took care of that. Yet the pangs of it began to hit him more frequently.
“Perhaps, I’m building immunity against Lifequil. They say it happens."
Lifequility-the wonder drug of Goshen and all Gaia. Mental-stimulant, muscle-builder, happiness-maker, sleep-suppressor (in high dosages), and sleep-repressor. Lifequility came in a variety of colors-all pastel, never melted, and lasted indefinately. “How did we ever survive without it,” he thought.
“Ahh…the Dark Ages. It must have been a miserable time. Who knew that changing a few molecules of McDonald’s secret sauce was all it took.”
Z-Tech manufactured Lifequil for the Goshen city-state. It’s production was ceaseless-24 hours a day, six days a week, 360 days a year-including X-mas and Aquarias Day. X-mas was also the date HAL first became functional, yet some people still insisted he was born in the springtide.
He re-entered Goshen Station, boarded the same mag-lev train, and sat down by a perky blond girl that was evidently enjoying a private rock concert of her very own if her gyrations were any indication. Maurice tried to avoid her and pretended to read a newspaper he’d found in the station lobby. After a minute or so, the perky blond took out her com-tel.
“You don’t look so chipper,” she perked “Take some Lifequil.”
“I’m fine, really.”
“You don’t look so happy,” she sighed. “You should look happy.”
“Are you happy?” he asked.
“What kinda’ question is that? You’re not weird are ya’?”
“No ma’am. I’m a biological researcher at Z-Tech Pharmaceutical, Industrial, and Culinary Consultants. We have a policy against weirdness…it’s in the SOP.”
(ed. note) This is actually true…Weirdness, oddness, introversion, avid book reading, religious activities, woodworking, non-tv watching, and uniqueness-in-general were frowned upon and documented in the official employee handbook under a chapter called ‘Deviant Employee Behavior and what to do about it.’
"Lifequil doesn’t make me happy-it makes me hyper. There’s a difference you know.”
“Oh my Gaia, you ARE weird,” she frowned. “I’ll tell the Controllers about you. HAL will make you happy. HAL makes everybody happy.”
The blond stared at Maurice for a full twenty seconds blankly then re-inserted her com-tel. Somewhere, someplace this conversation was being recorded…if not watched, and the words automatically sent to HAL for a keyword scan. He felt sure the conversation would pass the alerts. Maurice had a knack for carefully monitoring his conversation. Lately, there had been reports of increased crackdowns of possible terrorists and HAL had been busier than usual. He wasn’t sure if there were more terrorists or not. The media said there was, so it must be true, he thought. Or was it? In truth, he wasn’t sure about anything seen on the media anymore. Some of it seemed too far-fetched to be believed. Mediacon said the population of Gaia was holding steady at 6.6 billion, the optimum carrying-capacity of the planet. He figured this was about right. Goshen’s population was 300,000, average for a city-state, and one of 2,200 such places in the merry ole’ Virginia Commonwealth. The population of the Badlanders and Nekton was unknown. Everyone was happy, and healthy, and safe. The pre-ill were carefully monitored and at the first sign of illness, sent to the Hives for treatment. Need a new liver? The Hives could make you one.
The train lurched to a halt. The blond girl put a packet of Lifequil in his hand.
“Take these. Please. They’ll do a body good.”
Maurice nodded, “Thanks…”
“You’ve got to get in the groove, man. Get with it. You gotta’ be running high.” She smiled.
He put the pills in his pocket and walked the half-block back to his apartment under the watchful eyes of countless probes. He felt a twinge of sadness, not a good sign, and blamed it on being pre-ill. Soon, he would hear The Call and make his way to the Hives for medical testing.
"Thank HAL it’s not today,” he thought.
Maurice’s last visit to the Hives was 3-years-ago. He passed the med-alerts with flying colors. Sure, he had a genetic predisposition to melancholia, solitude, and obsessive-compulsive-reading disorder, but Lifequil took care of that. Yet the pangs of it began to hit him more frequently.
“Perhaps, I’m building immunity against Lifequil. They say it happens."
Lifequility-the wonder drug of Goshen and all Gaia. Mental-stimulant, muscle-builder, happiness-maker, sleep-suppressor (in high dosages), and sleep-repressor. Lifequility came in a variety of colors-all pastel, never melted, and lasted indefinately. “How did we ever survive without it,” he thought.
“Ahh…the Dark Ages. It must have been a miserable time. Who knew that changing a few molecules of McDonald’s secret sauce was all it took.”
Z-Tech manufactured Lifequil for the Goshen city-state. It’s production was ceaseless-24 hours a day, six days a week, 360 days a year-including X-mas and Aquarias Day. X-mas was also the date HAL first became functional, yet some people still insisted he was born in the springtide.
09 April 2011
Good Reads
05 April 2011
Page 15
"Sometimes the ridiculous is wisdom," said Jakob. He then walked over to the checker game, pulled up a chair, and watched Russell and Buck stare at the checkerboard in the faint hope that sometime in the near future, and hopefully before closing time, one of them would make a move. "As arachnodiculous as it sounds, I think Mr. Walder is right, Polly. We should work together on this thing." Polly leaned her face on her hand and slowly stirred Earl Grey. There was a faraway look to her eyes that writers, poets, artists, and husbands on shopping trips with their wives at Christmas oftentimes have. "My intuition tells me this will be dangerous, but you know Mr. Perez…I need a good adventure." "Just to be on the safe side," Maurice pulled a dark-blue matchbook-sized box from his coat pocket. "Stick this on your MG’s dash. It should keep our drones from zapping…Malachi." "Why-it’s adorable," said Polly. "I’m sure he’ll love it." "Another thing. Nobody else need know about this little machine. It’s a bit of a trade secret." "Mums the word," said Polly. * * * The next morning Maurice decided to take a train to work. At 7:50 A.M. he stepped from the train and entered the mob of workers. Wednesdays, he noticed, were one of the busiest days of the week, but Goshen Station was two minutes walk to Z-Tech. This particular Wednesday was like any other; people jostling one another in the streets, people standing in lines at St. Buck’s Coffee, everyone happy and medicated with varying amounts of Lifequil (a substance similar to caffeine and Altoids, and incidently produced by Z-Tech’s culinary division) coursing through their veins, com-tels (bluetooth devices) in nearly every ear…voice-activated to a mouthpiece in every shirt collar. Maurice felt uneasy. Something was wrong. He did not want to go to Z-Tech this morning, nor ever again. Something like a tangible presence told him to stop. He removed his com-tel and listened. He swore somebody told him to stop, but nobody approached him. Five seconds later he again stopped, and felt like he ran into a wall. Half a second later a short hairy man walked into him. "Watch where you’re going will ya'," growled Maurice. The man, sans com-tel and wearing a dirty janitor suit, glowered at him and passed by. He looked like an anemic chimpanzee. It wasn’t so much he had a lot of hair; he had a normal amount, but it covered proportionately less area compared to a normal man, and this fellow was only five-feet tall.
30 March 2011
Page 14
“The dream will answer your questions about the drone.”
He took the pipe out of his mouth, tapped it against his hand, and stuck it in his shirt pocket. “It’s for effect-really. I don’t actually smoke. I keep it in my mouth for safe-keeping. It’s a little like chicle in that regard.”
“Chicle?” asked Maurice.
“The perfect chemical. That’s what chewing gum is made of. A good wad of sugar-flavored chicle between the cheek and gum, massaging the salivary glands, is like manna from Wrigleys. Even better than squid…from my sea-faring days…and chicle grows in trees and won’t squirt you with ink. Nor will a chicle tree try to eat you should you fall overboard.”
Polly smiled. “I do same thing with much of the food I review. I don’t actually eat the horrid stuff. I simply observe it and visualize how it affects my taste buds. You’d be surprised how accurate this is.”
Maurice wondered why he didn’t think of this before the spamburgers arrived and made a mental note to mentally try squid someday.
“About the dream, Mr. Walder. You we’re saying…”
“Yes, yes-the dream. Do you believe in Predestination?”
“Why yes I do,” said Polly.
“I believe in Fate,” said Maurice.
“What would you say if I told you I dreamed the two of you would be sitting here with me, and Ell, and Scrap Iron, and Russell, and Buck (This must be the two checker players thought Maurice) on April the 1st, 2011?”
“Today is the last day of March,” said Maurice.
“Not in New Zealand,” chimed Polly.
“Predestination is like being a character in a book. The book has already been written and it’s up to us to decide who plays all the parts.”
“Oh…Ok,” said Maurice. “But who wrote the book?”
Jakob ignored the question. “Threads. Each of us, and you two in particular, are a single strand of thread connected to the Creator of Life…you can think of him as the writer of the Book of Life too. In my dream I saw two strands working together to create a mesh that stopped a great evil from poisoning the planet. The evil has many names and is real. I think you called him Destruction in your dream, Mr. Perez.”
Maurice’s heart skipped a beat and he felt his face grow warm.
“These microchips Z-Tech inserts into people…yes, I know about them. They bother you and not just a little bit. It’s a bit unsettling how they use facial recognition algorithmns to recognize and track aliens.
You know with your heart this…this numbering and tracking…is wrong, but do not know why.”
“And Polly-you are an artist and writer and intuitively know why beauty and uniqueness is important in life. You also hate spiders.”
Polly jerked and nearly knocked her tea on the floor. She considered spiders as little incarnations of evil and had a particularly bad nightmare about a very large tarantula the night before.
“The two of you should work together to fight this encroachment of civil liberties. Now in my dream, I saw the two strands weaving a web that trapped this great beast.”
“Please Mr. Walder, this sounds exciting, but it’s a little…fantastic, and unsettling, and…and…”
“Arachnodiculous,” said Maurice.
“Yes. Arachno…arachna…what Maurice just said,” said Polly.
He took the pipe out of his mouth, tapped it against his hand, and stuck it in his shirt pocket. “It’s for effect-really. I don’t actually smoke. I keep it in my mouth for safe-keeping. It’s a little like chicle in that regard.”
“Chicle?” asked Maurice.
“The perfect chemical. That’s what chewing gum is made of. A good wad of sugar-flavored chicle between the cheek and gum, massaging the salivary glands, is like manna from Wrigleys. Even better than squid…from my sea-faring days…and chicle grows in trees and won’t squirt you with ink. Nor will a chicle tree try to eat you should you fall overboard.”
Polly smiled. “I do same thing with much of the food I review. I don’t actually eat the horrid stuff. I simply observe it and visualize how it affects my taste buds. You’d be surprised how accurate this is.”
Maurice wondered why he didn’t think of this before the spamburgers arrived and made a mental note to mentally try squid someday.
“About the dream, Mr. Walder. You we’re saying…”
“Yes, yes-the dream. Do you believe in Predestination?”
“Why yes I do,” said Polly.
“I believe in Fate,” said Maurice.
“What would you say if I told you I dreamed the two of you would be sitting here with me, and Ell, and Scrap Iron, and Russell, and Buck (This must be the two checker players thought Maurice) on April the 1st, 2011?”
“Today is the last day of March,” said Maurice.
“Not in New Zealand,” chimed Polly.
“Predestination is like being a character in a book. The book has already been written and it’s up to us to decide who plays all the parts.”
“Oh…Ok,” said Maurice. “But who wrote the book?”
Jakob ignored the question. “Threads. Each of us, and you two in particular, are a single strand of thread connected to the Creator of Life…you can think of him as the writer of the Book of Life too. In my dream I saw two strands working together to create a mesh that stopped a great evil from poisoning the planet. The evil has many names and is real. I think you called him Destruction in your dream, Mr. Perez.”
Maurice’s heart skipped a beat and he felt his face grow warm.
“These microchips Z-Tech inserts into people…yes, I know about them. They bother you and not just a little bit. It’s a bit unsettling how they use facial recognition algorithmns to recognize and track aliens.
You know with your heart this…this numbering and tracking…is wrong, but do not know why.”
“And Polly-you are an artist and writer and intuitively know why beauty and uniqueness is important in life. You also hate spiders.”
Polly jerked and nearly knocked her tea on the floor. She considered spiders as little incarnations of evil and had a particularly bad nightmare about a very large tarantula the night before.
“The two of you should work together to fight this encroachment of civil liberties. Now in my dream, I saw the two strands weaving a web that trapped this great beast.”
“Please Mr. Walder, this sounds exciting, but it’s a little…fantastic, and unsettling, and…and…”
“Arachnodiculous,” said Maurice.
“Yes. Arachno…arachna…what Maurice just said,” said Polly.
29 March 2011
Page 13
Maurice and the former statue shook hands.
"Pleased to meet you Jakob. May I introduce Polly B. Frottin? We're old friends from five minutes ago. One of my company's drones mistook her and Malachi for an unchip alien making a run for it."
Polly and Jakob shook hands. "Where were you going?"
"Borders...the bookstore. It's one of my homes away from home."
Jakob scratched his long dusty beard and gazed gravely at Maurice and Polly. The deep wrinkles about his eyes gave one the impression of great wisdom-of a deep knowledge of scientific and philosophical subjects. His eyes twinkled and made Polly think of Michelangelo's Moses, but without the horns. They were the most distinctive feature of his face. Set farther apart than usual, they gave him a remarkable field of vision. His deep penetrating gaze at Maurice seemed to slice to his inner being. One could tell at once that before him stood a man that perceived much more than most. Both felt drawn to him immediately.
"I had a dream about the you of you."
"Pleased to meet you Jakob. May I introduce Polly B. Frottin? We're old friends from five minutes ago. One of my company's drones mistook her and Malachi for an unchip alien making a run for it."
Polly and Jakob shook hands. "Where were you going?"
"Borders...the bookstore. It's one of my homes away from home."
Jakob scratched his long dusty beard and gazed gravely at Maurice and Polly. The deep wrinkles about his eyes gave one the impression of great wisdom-of a deep knowledge of scientific and philosophical subjects. His eyes twinkled and made Polly think of Michelangelo's Moses, but without the horns. They were the most distinctive feature of his face. Set farther apart than usual, they gave him a remarkable field of vision. His deep penetrating gaze at Maurice seemed to slice to his inner being. One could tell at once that before him stood a man that perceived much more than most. Both felt drawn to him immediately.
"I had a dream about the you of you."
23 March 2011
Page 12 (For those of you who have been waiting)
Polly Bee Frottin, Ell, Earl Grey, and two plates with two rectangle-shaped cheeseburgers arrived at the same time.
"Over here, Miss Frottin," said Maurice as he lifted his hand."Do you know why I asked to meet you today?"
"I believe it has to do with one of Z-Tech's drones playing laser tag with Malachi."
"Malachi?"
"My MG roadster. I named him after malachite. It's a dark greeny rock used in jewelry and architecture. It's also used to celebrate one's 13-year-wedding anniversary."
Maurice felt an odd sensation in his belly at this thought. "Thirteen years is a long time you know," he sighed.
"And I'm not being facetious either. And to be even more truthful, I don't even know what facetious means." She said this in the same tone of voice people use when disputing speeding tickets. "It simply feels like the right thing to say. It's an intuitive thing really. It's the right and proper thing to do. Like not eating spam. You know you should never eat spam because it will do nasty things to your liver and kidneys."
"I...I...think they used...spam for hamburger." Polly gazed mournfully at Maurice, gazed even more mournfully at her food. Then drastically cheered up when she spotted 'Scrap Iron' open a mournful eye. And before you could say the sixth sick sheik's sixth sheep's sick, Polly removed the spam and tossed it into the general direction of the dog. "You would not be-lieve how many menu fiascos I've read these past three years," Polly continued.
"You...um...write manifestos?"
"Menu fiascos...It's part of my job at the Times. Every Saturday I travel to a new restaurant, deli, cafe, diner...what have you...and write a review for the Sunday edition"
"I see." Maurice stared at his spamburger and thanked God he didn't order the catfish souffle.
"Bless this meat, darn the skin, while I cover my nose, and cram it in."
Maurice lowered his voice, "I have never considered myself an overly-religious man, but sometimes it is better to be safe than sorry."
"Ah-chhoo!"
The statue sneezed.
"Gesundheit!" said Maurice and Polly simultaneously.
"Vielen Dank," replied the statue in a very unstatue-like and vaguely German way.
"O' goodness," whispered Polly. "Pinnochio...is...real."
"I could not help but overhear your conversation," said the apparently real man. "By the way, my name is Jakob Walder."
"Over here, Miss Frottin," said Maurice as he lifted his hand."Do you know why I asked to meet you today?"
"I believe it has to do with one of Z-Tech's drones playing laser tag with Malachi."
"Malachi?"
"My MG roadster. I named him after malachite. It's a dark greeny rock used in jewelry and architecture. It's also used to celebrate one's 13-year-wedding anniversary."
Maurice felt an odd sensation in his belly at this thought. "Thirteen years is a long time you know," he sighed.
"And I'm not being facetious either. And to be even more truthful, I don't even know what facetious means." She said this in the same tone of voice people use when disputing speeding tickets. "It simply feels like the right thing to say. It's an intuitive thing really. It's the right and proper thing to do. Like not eating spam. You know you should never eat spam because it will do nasty things to your liver and kidneys."
"I...I...think they used...spam for hamburger." Polly gazed mournfully at Maurice, gazed even more mournfully at her food. Then drastically cheered up when she spotted 'Scrap Iron' open a mournful eye. And before you could say the sixth sick sheik's sixth sheep's sick, Polly removed the spam and tossed it into the general direction of the dog. "You would not be-lieve how many menu fiascos I've read these past three years," Polly continued.
"You...um...write manifestos?"
"Menu fiascos...It's part of my job at the Times. Every Saturday I travel to a new restaurant, deli, cafe, diner...what have you...and write a review for the Sunday edition"
"I see." Maurice stared at his spamburger and thanked God he didn't order the catfish souffle.
"Bless this meat, darn the skin, while I cover my nose, and cram it in."
Maurice lowered his voice, "I have never considered myself an overly-religious man, but sometimes it is better to be safe than sorry."
"Ah-chhoo!"
The statue sneezed.
"Gesundheit!" said Maurice and Polly simultaneously.
"Vielen Dank," replied the statue in a very unstatue-like and vaguely German way.
"O' goodness," whispered Polly. "Pinnochio...is...real."
"I could not help but overhear your conversation," said the apparently real man. "By the way, my name is Jakob Walder."
21 March 2011
Page 11
Maurice sauntered into the Dew Drop Inn whistling a modified version of the 'Theme to the Pink Panther.' He cared not that the lady sitting by the cash register reading Good Housekeeping hardly noticed as he walked in. Two minutes later, he grew antsy when she was still reading the magazine.
The Pink Panther merged into the theme song to Jeopardy.
Two more minutes passed and she showed no signs of moving. He peered over her shoulder to find her engrossed in an article concerning global warming and the evolution of ceramic cats.
Jeopardy ended. She turned to him and asked,
"What is this world coming to?"
"They say it will come to an end," he replied.
The woman's name tag read Ell. Maurice figured it was a typo or she was trying to curse like the British.
"I'll have two cups of Earl Grey tea, Ms. Ell. And two cheeseburgers."
The Dew Drop Inn was a rustic sort of place. It was part gas station, part convenience store, part restaurant, and part moose lodge. The convenience part resembled a 1980's era Soviet grocery store; a box of Corn Flakes, some matches, those little spoons with flags on them, a stack of dusty Spam. . .and all watched over by a dog of dubious lineage named 'Scrap Iron' in the corner. He sat down by the window and watched as two old men stared intently at a dirty checkerboard. The first man resembled a mannequin; the second man resembled the first man, but talked even less. Neither got invited to many parties, had wooden personalities, and enjoyed watching Lawrence Welk and re-runs of Hee-Haw for hours on end with nary so much as moving a finger. It is rather difficult to explain how Maurice knew this, but he had a well-developed intuition concerning people which was one reason he felt called to be a monk.
In another corner stood a statue that looked to be whittled from a Hickory tree. A corncob pipe was stuck in it's mouth and it had a sort of crooked nose that if an inch shorter would make it appear almost life-like. It was rather dusty and he wondered why Ell didn't vacuum it's shaggy beard more often.
The Pink Panther merged into the theme song to Jeopardy.
Two more minutes passed and she showed no signs of moving. He peered over her shoulder to find her engrossed in an article concerning global warming and the evolution of ceramic cats.
Jeopardy ended. She turned to him and asked,
"What is this world coming to?"
"They say it will come to an end," he replied.
The woman's name tag read Ell. Maurice figured it was a typo or she was trying to curse like the British.
"I'll have two cups of Earl Grey tea, Ms. Ell. And two cheeseburgers."
The Dew Drop Inn was a rustic sort of place. It was part gas station, part convenience store, part restaurant, and part moose lodge. The convenience part resembled a 1980's era Soviet grocery store; a box of Corn Flakes, some matches, those little spoons with flags on them, a stack of dusty Spam. . .and all watched over by a dog of dubious lineage named 'Scrap Iron' in the corner. He sat down by the window and watched as two old men stared intently at a dirty checkerboard. The first man resembled a mannequin; the second man resembled the first man, but talked even less. Neither got invited to many parties, had wooden personalities, and enjoyed watching Lawrence Welk and re-runs of Hee-Haw for hours on end with nary so much as moving a finger. It is rather difficult to explain how Maurice knew this, but he had a well-developed intuition concerning people which was one reason he felt called to be a monk.
In another corner stood a statue that looked to be whittled from a Hickory tree. A corncob pipe was stuck in it's mouth and it had a sort of crooked nose that if an inch shorter would make it appear almost life-like. It was rather dusty and he wondered why Ell didn't vacuum it's shaggy beard more often.
16 March 2011
Page 10
At 4 P.M. that same day, an observer at the right altitude would have seen a small, British racing-green blur and a long, pink, horizontal flapping blur, dangling from a flesh-colored round thing as it tore along the road leading from Canaan Valley to Goshen, Va. The same observer might also have seen a silver Mercedes C280 driving on the same road at a speed roughly consistent with the 45 m.p.h. speed limit.
At 4:15 P.M. the same observer would have seen a well-dressed man in his mid-thirties park the C280 outside the Dew Drop Inn. Twenty minutes later the same observer, if his hot-air balloon hadn’t drifted away, might have seen the same British racing-green blur screech to a halt in the same parking lot. Watch as an attractive young woman in her late twenties and pink scarf with reddish-blond hair exits the former blur and shake her head violently as she looks at her watch. And, observe her pick up a stick and poke the grill of her car, and grimace as she removes something that might have been a small flying creature in a past life.
The man would be Mr. Maurice Perez originally from the melancholic state of Maine, and current resident of Goshen, Va. The woman would be Miss Polly Bee Frottin, lifestyle editor of the Shenandoah Valley Times, only daughter of Mr. Ludwig Van Frottin, current resident of Canaan Valley, WV, and murderer of her third Picoides borealis…sometimes known as the Red-headed Cockaded woodpecker as the compilers of the U.S. Fish and Wildlife Endangered Species List affectionately like to call it.
At 4:15 P.M. the same observer would have seen a well-dressed man in his mid-thirties park the C280 outside the Dew Drop Inn. Twenty minutes later the same observer, if his hot-air balloon hadn’t drifted away, might have seen the same British racing-green blur screech to a halt in the same parking lot. Watch as an attractive young woman in her late twenties and pink scarf with reddish-blond hair exits the former blur and shake her head violently as she looks at her watch. And, observe her pick up a stick and poke the grill of her car, and grimace as she removes something that might have been a small flying creature in a past life.
The man would be Mr. Maurice Perez originally from the melancholic state of Maine, and current resident of Goshen, Va. The woman would be Miss Polly Bee Frottin, lifestyle editor of the Shenandoah Valley Times, only daughter of Mr. Ludwig Van Frottin, current resident of Canaan Valley, WV, and murderer of her third Picoides borealis…sometimes known as the Red-headed Cockaded woodpecker as the compilers of the U.S. Fish and Wildlife Endangered Species List affectionately like to call it.
14 March 2011
Page 9
The entire chip and drone project bothered Maurice. The concept of implanting microchips into a certain class of people, (even with good intentions), simply did not seem right. He felt like an accomplice in a plot to debase humans-to lower them to the level of mere animals and rank them like so many herd of cattle.
Little did most know that aliens were not the only ones with embedded microchips. Many members of congress, all U.S. ambassadors, some high-ranking military officers, all NFL football players, nearly all U.S. prisoners, and an untold number of the elderly secretly had the Z-Tech chips. Maurice knew this and also knew of the little-known law that should a major catastrophe strike, all U.S. citizens would be embedded…with or without their consent.
‘The Z-Tech chips are really a form of slavery,’ he thought on more than one occasion…’and should more drones mis-fire…’
Maurice grimaced. He stared at the disassembled drone and said,
“Put Humpy-Dumpty back together again…only this time insert a new un-used facial recognizance microchip and perform another test run.”
“But all the rats are gone boss.”
“Use the chimps…and lower the voltage. We don’t want another accident on our hands.”
“Yes, boss.”
Maurice returned to his office.
“Candy-I want you to get me the telephone number of a Polly Frottin.”
“A Polly-what?” she asked.
“A Miss Polly Frottin. She’s the first non-alien to get zapped in seven years by one of our drones.”
Is Polly her real name? It sounds like a screen name…or a foreign name…or one of those names people use when they turn recluse, and introverted, and hide out in a log cabin in Utah and write manifestos.”
“I don’t think Polly writes manifestos, Candy”
“Then what does she write….Hmmmm?”
“I don’t know that she writes anything. I do know we need to find a cure for this seven-year-hitch.”
“Yes, we do,” Candy replied in a voice only a rabbit would hear.
Little did most know that aliens were not the only ones with embedded microchips. Many members of congress, all U.S. ambassadors, some high-ranking military officers, all NFL football players, nearly all U.S. prisoners, and an untold number of the elderly secretly had the Z-Tech chips. Maurice knew this and also knew of the little-known law that should a major catastrophe strike, all U.S. citizens would be embedded…with or without their consent.
‘The Z-Tech chips are really a form of slavery,’ he thought on more than one occasion…’and should more drones mis-fire…’
Maurice grimaced. He stared at the disassembled drone and said,
“Put Humpy-Dumpty back together again…only this time insert a new un-used facial recognizance microchip and perform another test run.”
“But all the rats are gone boss.”
“Use the chimps…and lower the voltage. We don’t want another accident on our hands.”
“Yes, boss.”
Maurice returned to his office.
“Candy-I want you to get me the telephone number of a Polly Frottin.”
“A Polly-what?” she asked.
“A Miss Polly Frottin. She’s the first non-alien to get zapped in seven years by one of our drones.”
Is Polly her real name? It sounds like a screen name…or a foreign name…or one of those names people use when they turn recluse, and introverted, and hide out in a log cabin in Utah and write manifestos.”
“I don’t think Polly writes manifestos, Candy”
“Then what does she write….Hmmmm?”
“I don’t know that she writes anything. I do know we need to find a cure for this seven-year-hitch.”
“Yes, we do,” Candy replied in a voice only a rabbit would hear.
09 March 2011
Page 8
In the early days, the drones had trouble distinguishing non-chipper aliens from non-chipper natives and the problem was thought to be solved with the newest advances in facial recognition software.
Until recently.
On one of her Sunday afternoon adventures, Miss Polly Frottin was zapped by a Z-Tech drone as she was speeding down Rt.66 between Canaan Valley, WV and Goshen, VA. The day was warm and sunny, the music was blaring, and the top was down on her little green MG roadster. The theory held by the technicians was the drone was momentarily confused by the blur of flashing green (the car) and Miss Polly’s windswept hair (reddish-blond), along with her Ray-Ban Wayfarer sunglasses. The combination must have given the drone the impression of a very unchip alien who was late for work.
Fortunately, the laser merely shocked her car and aside from the complete inability of her car stereo to tune into NPR, left Miss Polly unscathed. She promptly stopped her car at a quaint little deli and gas station called Quaker Steaks and Lube and told the owner, “Take a look at my car. It seems to be producing quite a bit of static electricity…oh’ and I’ll have a cheese steak sandwich, fries, and 5 quarts of motor oil if you please.”
The incident might have been forgotten except that three days later another incident involving the same drone occurred.
Witnesses at the scene reported that approximately 2:30 P.M. a Z-Tech drone zapped the mayor of Goshen’s girlfriend…a one Miss Petunia C. Noggins…just minutes after she left the Blue Moose beauty salon and Wrinkle Reduction Centre with a new haircut and botox injections. Miss Noggins was madder than a hornet and threatened to report the crime to the local papers when the wise and very rich mayor persuaded her to maintain a low profile and that he would talk to one of the Z-Tech scientists himself.
That was yesterday and the scientist happened to be Maurice.
Until recently.
On one of her Sunday afternoon adventures, Miss Polly Frottin was zapped by a Z-Tech drone as she was speeding down Rt.66 between Canaan Valley, WV and Goshen, VA. The day was warm and sunny, the music was blaring, and the top was down on her little green MG roadster. The theory held by the technicians was the drone was momentarily confused by the blur of flashing green (the car) and Miss Polly’s windswept hair (reddish-blond), along with her Ray-Ban Wayfarer sunglasses. The combination must have given the drone the impression of a very unchip alien who was late for work.
Fortunately, the laser merely shocked her car and aside from the complete inability of her car stereo to tune into NPR, left Miss Polly unscathed. She promptly stopped her car at a quaint little deli and gas station called Quaker Steaks and Lube and told the owner, “Take a look at my car. It seems to be producing quite a bit of static electricity…oh’ and I’ll have a cheese steak sandwich, fries, and 5 quarts of motor oil if you please.”
The incident might have been forgotten except that three days later another incident involving the same drone occurred.
Witnesses at the scene reported that approximately 2:30 P.M. a Z-Tech drone zapped the mayor of Goshen’s girlfriend…a one Miss Petunia C. Noggins…just minutes after she left the Blue Moose beauty salon and Wrinkle Reduction Centre with a new haircut and botox injections. Miss Noggins was madder than a hornet and threatened to report the crime to the local papers when the wise and very rich mayor persuaded her to maintain a low profile and that he would talk to one of the Z-Tech scientists himself.
That was yesterday and the scientist happened to be Maurice.
05 March 2011
The Maine Character
http://themainecharacter.tumblr.com/
Follow the link above to continue reading about The Adventures of Maurice the Maine character...a work in progress...(and sometimes regress)
Follow the link above to continue reading about The Adventures of Maurice the Maine character...a work in progress...(and sometimes regress)
Page 7
The Class E α–male drone was specifically designed by Z-Tech to hover soundlessly over the countryside as an un-manned surveillance craft to guard against illegal alien entry and activities. Legal aliens, however, were judged to be good for the economy and welcomed with open arms and coupons for free drinks at the local taverns. This was primarily due to some undisclosed wild rave parties reputably held in Roswell, New Mexico during the 1940’s that government agents to this day still rarely talk about.
The big problem was determining the legality of an alien.
Z-Tech’s answer was to insert a rice-sized microchip into the legal alien’s arm. Because of its tiny size, it was practically undetectable once embedded. A polyethylene cover helped the chip bond with the skin to prevent migration.
The chip worked in much the same manner as the bar code scanner at your local grocery store. Only instead of a bar code, one has the half inch long microchip in your shoulder. When a scanner or reader passed over, a radio signal energized the dormant microchip which then transmitted a unique sixteen digit identification number. This number was used to provide access to a secure database in Switzerland containing the person’s complete medical history, bank records, and ability to have a good time.
So if the drone detected an unchipped alien…an unchipper one, it immediately zapped it with a laser which reminded it to lighten up and get a chip in it’s shoulder. If, after a reasonable period of time, the illegal alien still did not get a chip in it’s shoulder, the drone zapped the illegal alien with an even more compelling reminder to hurry things up a bit, as everyone knows foreigners with chips in their shoulders tell really good stories and do neat tricks that natives general haven’t thought about.
The big problem was determining the legality of an alien.
Z-Tech’s answer was to insert a rice-sized microchip into the legal alien’s arm. Because of its tiny size, it was practically undetectable once embedded. A polyethylene cover helped the chip bond with the skin to prevent migration.
The chip worked in much the same manner as the bar code scanner at your local grocery store. Only instead of a bar code, one has the half inch long microchip in your shoulder. When a scanner or reader passed over, a radio signal energized the dormant microchip which then transmitted a unique sixteen digit identification number. This number was used to provide access to a secure database in Switzerland containing the person’s complete medical history, bank records, and ability to have a good time.
So if the drone detected an unchipped alien…an unchipper one, it immediately zapped it with a laser which reminded it to lighten up and get a chip in it’s shoulder. If, after a reasonable period of time, the illegal alien still did not get a chip in it’s shoulder, the drone zapped the illegal alien with an even more compelling reminder to hurry things up a bit, as everyone knows foreigners with chips in their shoulders tell really good stories and do neat tricks that natives general haven’t thought about.
03 March 2011
Life in the Desert

There is something about solitude that draws men closer to the heart of God. In a silent world, it is easier to perceive the Holy Spirit tugging at your heart strings-urging you to come closer and closer to His presence-leading you deeper and deeper into a reality more real and vivid than you've ever known before. It is in the silent places one most feels the Holy Spirit pressing upon you-covering you like a blanket and yearning for something your heart desires more than anything in the world. Something richer, deeper, more intimate, and fulfilling than all the best things you can imagine combined. Something inarticulable. The Something has parallels and shadows in this world, yet as good as these may be, they are only a hint of what will be experienced moments after one closes one's eyes for the last time on planet Earth.
Page 6
“A-hem,” his neighbor coughed. “Well Maurice, I do hope you get some rest. You look positively exhausted.” And with that he trudged off to his bright red barn.
The dream bothered Maurice. Why did not the giant recognize him? Was he really hidden from his view? One thing was certain-‘getting back to nature’ was for the birds and the furry woodland creatures who regularly visited his backyard garden during their nocturnal shopping trips. Another thing that was certain was his need to be at work in a couple of hours looking like he had a good night’s sleep.
At exactly 7:58 A.M. Maurice walked through the double-paned glass doors of Z-Tech Pharmaceutical, Industrial, and Culinary Consultants, Inc.
“Good morning Maurice,” came the cheery voice of Candy Skipper.
“Any messages?” he asked.
Candy Skipper, fond of chewing-gum, mini-skirts, different hair styles, and Celtic pewter jewelry was his secretary. She was his complete opposite, yet for obscure reasons unfathomable to her creative mind, she had developed something similar to, but not quite exactly like a crush on Maurice. It was more like the affection a cave-woman feels towards a large woolly mammoth sweater with a hole in the shoulder. A sweater that keeps one warm on those cold Ice Age nights during college basketball season, but lets in just enough cold drafty air to act as an irritant. Whether he knew this is a matter of some debate, but Candy, due to her unique mindset, felt it would be a serious social faux pas to come out and tell him.
In celebration of pay day, Candy wore green hair, gold shirt, and silver skirt.
“The techies have been calling all morning. They’re down in room 312…”
The drone lay on a white table. Its insides spread out like a bad car wreck.
“What have you found?” asked Maurice.
“Nothing.”
“At all?”
“To speak of. All the systems were working properly, at least until we completely disassembled everything.”
“I want a test run.”
“We’ve done that.”
“And?”
“It went perfectly. Killed all our test rats in one fell swoop. Even Smart Sparky got zapped.”
“Sparky’s dead?”
“Tragic, I know boss…but science is science.”
The dream bothered Maurice. Why did not the giant recognize him? Was he really hidden from his view? One thing was certain-‘getting back to nature’ was for the birds and the furry woodland creatures who regularly visited his backyard garden during their nocturnal shopping trips. Another thing that was certain was his need to be at work in a couple of hours looking like he had a good night’s sleep.
At exactly 7:58 A.M. Maurice walked through the double-paned glass doors of Z-Tech Pharmaceutical, Industrial, and Culinary Consultants, Inc.
“Good morning Maurice,” came the cheery voice of Candy Skipper.
“Any messages?” he asked.
Candy Skipper, fond of chewing-gum, mini-skirts, different hair styles, and Celtic pewter jewelry was his secretary. She was his complete opposite, yet for obscure reasons unfathomable to her creative mind, she had developed something similar to, but not quite exactly like a crush on Maurice. It was more like the affection a cave-woman feels towards a large woolly mammoth sweater with a hole in the shoulder. A sweater that keeps one warm on those cold Ice Age nights during college basketball season, but lets in just enough cold drafty air to act as an irritant. Whether he knew this is a matter of some debate, but Candy, due to her unique mindset, felt it would be a serious social faux pas to come out and tell him.
In celebration of pay day, Candy wore green hair, gold shirt, and silver skirt.
“The techies have been calling all morning. They’re down in room 312…”
The drone lay on a white table. Its insides spread out like a bad car wreck.
“What have you found?” asked Maurice.
“Nothing.”
“At all?”
“To speak of. All the systems were working properly, at least until we completely disassembled everything.”
“I want a test run.”
“We’ve done that.”
“And?”
“It went perfectly. Killed all our test rats in one fell swoop. Even Smart Sparky got zapped.”
“Sparky’s dead?”
“Tragic, I know boss…but science is science.”
Page 5
Maurice, though, had never drunk alcohol in his life.
There was really no reason why. People offered him drinks plenty of times and he always politely refused with the simple reply,
“No thanks. I’m abstaining until marriage or 2050 A.D…whichever comes first.”
Maurice thought long and hard about this and believed his refusal of alcohol was a subconscious rejection of something else entirely. That is, beer and wine were a metaphor for some innate hated thing that wronged him in his formative years. In this, Id and Ego agreed.
“What could it be,” he thought. “Is it grapes?”
Grapes were not his favorite fruit. They looked good on the outside, but were soft and mushy in the middle. And there was always that infernal seed lurking inside that ruined any hope of a joyful culinary experience. But seedless grapes existed. He loved seedless grapes.
“Could it be the yellow jackets that built their paper homes in my parent’s vineyards?”
That didn’t seem right either. He brooded more over the situation.
“Seeds, yellow jackets, paper houses, cheap houses, trailer park ’houses’, purple trailer park houses, seedy houses, back to the infernal seeds again, mushy middles…” Something sinister lurked in man’s history concerning the purple fruit of the vine.
“Vine, whine, wine…”
Martin Luther said, “He who loves not wine, women, and song remains a fool his whole life long.”
“Perhaps I should drink wine,” he said aloud and rather quickly. “Was it not Pliny the Elder who said, “In wine there is truth.” And truth be told he was on a life-long search for truth.
There was really no reason why. People offered him drinks plenty of times and he always politely refused with the simple reply,
“No thanks. I’m abstaining until marriage or 2050 A.D…whichever comes first.”
Maurice thought long and hard about this and believed his refusal of alcohol was a subconscious rejection of something else entirely. That is, beer and wine were a metaphor for some innate hated thing that wronged him in his formative years. In this, Id and Ego agreed.
“What could it be,” he thought. “Is it grapes?”
Grapes were not his favorite fruit. They looked good on the outside, but were soft and mushy in the middle. And there was always that infernal seed lurking inside that ruined any hope of a joyful culinary experience. But seedless grapes existed. He loved seedless grapes.
“Could it be the yellow jackets that built their paper homes in my parent’s vineyards?”
That didn’t seem right either. He brooded more over the situation.
“Seeds, yellow jackets, paper houses, cheap houses, trailer park ’houses’, purple trailer park houses, seedy houses, back to the infernal seeds again, mushy middles…” Something sinister lurked in man’s history concerning the purple fruit of the vine.
“Vine, whine, wine…”
Martin Luther said, “He who loves not wine, women, and song remains a fool his whole life long.”
“Perhaps I should drink wine,” he said aloud and rather quickly. “Was it not Pliny the Elder who said, “In wine there is truth.” And truth be told he was on a life-long search for truth.
23 February 2011
Page 4
“Good morning Mr. Zarbad. How are you today?”
“So far, so good. Off to the barn to feed Betsy and Jude.”
“Hey-that rhymes.”
“And tastes better when chewed.”
*editor’s note. Maurice’s neighbor, a one Mr. William ‘Wild Bill” Zarbad, does not appear anymore in this book under the guise of an aging Irish-American who raises sheep and dairy cattle in Goshen, Virginia. Instead, he appears as an un-named entity who…well, you can find out for yourself if he appears later.
Now it is a curious fact of nature that for the majority of history, mankind has more often than not, slept outside. The reasons are varied; a keen love of the stars, a voyage at sea, overcrowded tents, camping, an argument with the wife, perhaps even a miscalculation on the final date of one’s apartment lease and the start date of another. But in the Twenty-first century, it is a widely held notion that slumber should be carried indoors in a bed with four pillows, two blankets, 2 sheets, a comforter, beside an oak dresser holding a glass of water chilled to 45 Fahrenheit atop a hand-carved wooden coaster, a novel written by a British author deceased for a minimum of 30 years (unless it’s a cheap paperback), a box of kleenex, resting under a lamp, and quite possibly near a hand-carved cedar box from Lebanon containing gold, frankincense, and myrrh. Furthermore, to be discovered outdoors covered in frost in one’s lawn chair at dawn is considered most unusual behavior…even when alcohol is involved.
Maurice, though, had never drunk alcohol in his life.
“So far, so good. Off to the barn to feed Betsy and Jude.”
“Hey-that rhymes.”
“And tastes better when chewed.”
*editor’s note. Maurice’s neighbor, a one Mr. William ‘Wild Bill” Zarbad, does not appear anymore in this book under the guise of an aging Irish-American who raises sheep and dairy cattle in Goshen, Virginia. Instead, he appears as an un-named entity who…well, you can find out for yourself if he appears later.
Now it is a curious fact of nature that for the majority of history, mankind has more often than not, slept outside. The reasons are varied; a keen love of the stars, a voyage at sea, overcrowded tents, camping, an argument with the wife, perhaps even a miscalculation on the final date of one’s apartment lease and the start date of another. But in the Twenty-first century, it is a widely held notion that slumber should be carried indoors in a bed with four pillows, two blankets, 2 sheets, a comforter, beside an oak dresser holding a glass of water chilled to 45 Fahrenheit atop a hand-carved wooden coaster, a novel written by a British author deceased for a minimum of 30 years (unless it’s a cheap paperback), a box of kleenex, resting under a lamp, and quite possibly near a hand-carved cedar box from Lebanon containing gold, frankincense, and myrrh. Furthermore, to be discovered outdoors covered in frost in one’s lawn chair at dawn is considered most unusual behavior…even when alcohol is involved.
Maurice, though, had never drunk alcohol in his life.
Page 3
“Who are you?” bellowed the stony being. “You don’t belong here.”
Maurice tried to answer but his throat was parched and his tongue cleaved to the roof of his mouth.
“Speak!” roared the giant.
He perceived the giant could not see him and had only a vague idea of his location. The giant walked closer and closer until his shadow fell on Maurice. His blood ran chill as a deathly coldness overtook him.
“Maurice! MAURICE! Wake up!”
He opened his eyes to find the dawn sky, a cold fire, and his next door neighbor wearing red pajamas staring at him and holding a pitchfork. His watch read 6:06:06 A.M.
Maurice tried to answer but his throat was parched and his tongue cleaved to the roof of his mouth.
“Speak!” roared the giant.
He perceived the giant could not see him and had only a vague idea of his location. The giant walked closer and closer until his shadow fell on Maurice. His blood ran chill as a deathly coldness overtook him.
“Maurice! MAURICE! Wake up!”
He opened his eyes to find the dawn sky, a cold fire, and his next door neighbor wearing red pajamas staring at him and holding a pitchfork. His watch read 6:06:06 A.M.
20 February 2011
Page 2
One day after work Maurice decided to camp out in his backyard. He wanted to ‘get back to nature’ and get used to the outdoor life in case the Trappist life didn’t work out and had to resort to the trappist life in Fairbanks. As night approached, Maurice found himself sitting on the ground stirring the embers of the campfire. He grew sleepy and presently nodded off.
The fire burned low. The dancing flames grew tired and now the embers spent their time flickering messages to one another in varying shades of red. Snap! Pop! A blackened stick broke into three pieces. One landed on a cooler ember and encouraged it to join the conversation. Another ember grew overly animated as it lectured the others. Briefly, he flared up and for a time all drew their attention the the fiery preacher.
“Ashes to ashes and dust to dust! From cinder to tree to tinder to crust!”
Then, in fulfillment of his prophesy, the flames leaped and the spirit departed.
Sometime later the moon crept from behind the clouds and nudged Maurice awake. The moon returned to her grey cloudy veils and massaged his mind with the deepest suggestion. How long had the moon lived? Did she see the first man? Did she know the secrets of the longaeva? His spirit grew warmer as dawn approached. The moonbeams rekindled the fire which then transferred its heat to his body. Off in the distance, an owl leaped to wing and descended upon a vole. A family of foxes trooped by just out of sight, paused for a look at the strange two-footed creature, then ambled off on their own business. The moon briefly revealed herself and sent a shaft of reflected light on Maurice. A shiver passed through him as again he nodded. He plunged into a dream.
It was not night; it was not day. It was simply a time that was. There were no stars, moon, or sun, merely a gloomy greyness. He stood on a large wooden platform at sea. Others were present, yet appeared as wraiths or shadows and called out as if in one voice. Not in words…but as beasts in agony…one long continuous groan. The platform rocked slowly and creaked like an old man in his death throes. Water lapped the edges and left frozen images of formless beings in its return to the water chaos. A loud voice bellowed from the midst of the wooden island. It rang of self-assurance, yet echoed a hollow wooden sound as one who remembered authority but had it stripped away in some forgotten past. A great being appeared in the likeness of a man. He looked like an unfinished statue. Stern and without pity, he walked towards Maurice and systematically beat the plankings. The being had no name, but destruction was his intent.
The fire burned low. The dancing flames grew tired and now the embers spent their time flickering messages to one another in varying shades of red. Snap! Pop! A blackened stick broke into three pieces. One landed on a cooler ember and encouraged it to join the conversation. Another ember grew overly animated as it lectured the others. Briefly, he flared up and for a time all drew their attention the the fiery preacher.
“Ashes to ashes and dust to dust! From cinder to tree to tinder to crust!”
Then, in fulfillment of his prophesy, the flames leaped and the spirit departed.
Sometime later the moon crept from behind the clouds and nudged Maurice awake. The moon returned to her grey cloudy veils and massaged his mind with the deepest suggestion. How long had the moon lived? Did she see the first man? Did she know the secrets of the longaeva? His spirit grew warmer as dawn approached. The moonbeams rekindled the fire which then transferred its heat to his body. Off in the distance, an owl leaped to wing and descended upon a vole. A family of foxes trooped by just out of sight, paused for a look at the strange two-footed creature, then ambled off on their own business. The moon briefly revealed herself and sent a shaft of reflected light on Maurice. A shiver passed through him as again he nodded. He plunged into a dream.
It was not night; it was not day. It was simply a time that was. There were no stars, moon, or sun, merely a gloomy greyness. He stood on a large wooden platform at sea. Others were present, yet appeared as wraiths or shadows and called out as if in one voice. Not in words…but as beasts in agony…one long continuous groan. The platform rocked slowly and creaked like an old man in his death throes. Water lapped the edges and left frozen images of formless beings in its return to the water chaos. A loud voice bellowed from the midst of the wooden island. It rang of self-assurance, yet echoed a hollow wooden sound as one who remembered authority but had it stripped away in some forgotten past. A great being appeared in the likeness of a man. He looked like an unfinished statue. Stern and without pity, he walked towards Maurice and systematically beat the plankings. The being had no name, but destruction was his intent.
16 February 2011
The Story Begins
Before we get started, let me say I have no idea where this story will go. It doesn't have a plot, nor does it have a main character. Actually it does have a main character...a Maine character. We'll call him Maurice. Maurice is seriously considering joining a Trappist monastery in Tennessee. And why not?
Maurice is not married. Once, a cashier asked him if he was single and he replied,
"no ma'am. I'm actually plural. I used to be single a very long time ago, but then I discovered Id and Ego. They're my invisible friends in a...um...very very complicated way."
The cashier miscalculated his change and so he donated the proceeds to Charity. A pretty homeless lass who made basket cases for a living.
Maurice hasn't had a girlfriend in 13 years...thirteen long and very unlucky years. The very thought of holding a girl's hand brings tears to his eyes. This used to bother him when it occurred in public, but some time ago he aquired a taste for Vidalia onions and garlic bread. Now when he weeps spontaneously in public, he blames it on the food.
This story is a happy one-really. Only Maurice doesn't know it yet.
Maurice hails from the little town of Bethel, Maine. Bethel is located halfway between Gilead (not that Gilead) and Paris (not that Paris.) I've never been to Gilead, or Paris, or even Maine (yes-that one) for that matter so you can just imagine what the places look like. Bethel, I'm sure, has a lot of churches and gets cold in the winter. Maurice doesn't live there anymore. He moved to Goshen. The Goshen in Virginia with warmer winters and less churches.
Thirteen years is quite a long time to live a monastic life without a monastery while still maintaining an air of normalcy in public. In private, it's easy as long as one keeps busy and maintains a prayer life. It's only natural Maurice wants to be a monk. It's peaceful and quiet. There's the free rent. And one gets to wear the same brown uniform-like the fellows in prison or the United States Forest Service.
Maurice believes with his whole heart that this is his life's calling. Now Maurice may or may not join the Brotherhood of Trappists. He may move to Alaska and work as a trappist-collecting beaver pelts and selling the fur to support his onion and garlic habits. Somehow, I think his life is about to change.
Maurice is not married. Once, a cashier asked him if he was single and he replied,
"no ma'am. I'm actually plural. I used to be single a very long time ago, but then I discovered Id and Ego. They're my invisible friends in a...um...very very complicated way."
The cashier miscalculated his change and so he donated the proceeds to Charity. A pretty homeless lass who made basket cases for a living.
Maurice hasn't had a girlfriend in 13 years...thirteen long and very unlucky years. The very thought of holding a girl's hand brings tears to his eyes. This used to bother him when it occurred in public, but some time ago he aquired a taste for Vidalia onions and garlic bread. Now when he weeps spontaneously in public, he blames it on the food.
This story is a happy one-really. Only Maurice doesn't know it yet.
Maurice hails from the little town of Bethel, Maine. Bethel is located halfway between Gilead (not that Gilead) and Paris (not that Paris.) I've never been to Gilead, or Paris, or even Maine (yes-that one) for that matter so you can just imagine what the places look like. Bethel, I'm sure, has a lot of churches and gets cold in the winter. Maurice doesn't live there anymore. He moved to Goshen. The Goshen in Virginia with warmer winters and less churches.
Thirteen years is quite a long time to live a monastic life without a monastery while still maintaining an air of normalcy in public. In private, it's easy as long as one keeps busy and maintains a prayer life. It's only natural Maurice wants to be a monk. It's peaceful and quiet. There's the free rent. And one gets to wear the same brown uniform-like the fellows in prison or the United States Forest Service.
Maurice believes with his whole heart that this is his life's calling. Now Maurice may or may not join the Brotherhood of Trappists. He may move to Alaska and work as a trappist-collecting beaver pelts and selling the fur to support his onion and garlic habits. Somehow, I think his life is about to change.
13 February 2011
Silence is Golden
"Those who love their own noise are impatient of everything else. They constantly defile the silence of the forests and the mountains and the sea. They bore through silent nature in every direction with their machines, for fear that the calm world might accuse them of their own emptiness. The urgency of their swift movement seems to ignore the tranquillity of nature by pretending to have a purpose. The loud plane seems for a moment to deny the reality of the clouds and of the sky, by its direction, its noise, and its pretended strength. The silence of the sky remains when the plane has gone. The tranquility of the clouds will remain when the plane has fallen apart. It is the silence of the world that is real. Our noise, our business, our purposes, and all our fatuous statements about our purposes, our business, and our noise: these are the illusion. God is present, and His thought is alive and awake in the fullness and depth and breadth of all the silences of the world. The Lord is watching in the almond trees [Jer 1.11, 12]. . . Whether the plane pass by tonight or tomorrow . . . whether the liner enters the harbor full of tourists or full of soldiers, the almond tree brings forth her fruit in silence.
"There are some men for whom a tree has no reality until they think of cutting it down . . . men who never look at anything until they decide to abuse it and who never even notice what they do not want to destroy. These men can hardly know the silence of love: for their love is the absorption of another person's silence into their own noise. And because they do not know the silence of love, they cannot know the silence of God . . . Who is bound, by His own law of Charity, to give life to all those whom He draws into His own silence."
--Thomas Merton in No Man is an Island
"There are some men for whom a tree has no reality until they think of cutting it down . . . men who never look at anything until they decide to abuse it and who never even notice what they do not want to destroy. These men can hardly know the silence of love: for their love is the absorption of another person's silence into their own noise. And because they do not know the silence of love, they cannot know the silence of God . . . Who is bound, by His own law of Charity, to give life to all those whom He draws into His own silence."
--Thomas Merton in No Man is an Island
12 January 2011
Short Story
"For Sale: Baby shoes, never worn"
--Attributed to Ernest Hemingway on a bet saying that he couldn't write a story in under seven words.
--Attributed to Ernest Hemingway on a bet saying that he couldn't write a story in under seven words.
01 January 2011
The Heart of God
The heart of God, what He desires most, is intimacy with Him. That's why we are here.
-God made us to know Him.
-God made each of us different so we would know different aspects of His being.
-God made man an incredibly complex creation, in the likeness of Himself, because He is incredibly complex.
The very worse thing we can do is shun God when He draws near to us. This, more than anything, pains Him and explains the unearthly coldness one feels when one rejects Him. Fortunately, God desires us so much He forgives our cold shoulders and gives us grace. This is why relationships that go awry hurt more than anything else...since we are made in God's image and have an innate desire for intimacy that supersedes all other desires.
Because man is so complex, this does not mean any man should marry any woman. Nor does this mean any Christian man should marry any Christian woman. I suspect God designs us so that there are really only a very few truly compatible people for living their lives together.
If one looks to the animal kingdom, one can see this more clearly. Mountain lions and lynxes, though they live in the same places, eat the same animals, chase the same sheep, and love to sleep 20+ hours a day are simply not made to be together. Granted, mankind is the same species, but this does not mean two Christians are made to be together. God may have different plans for both, though they walk along the same path for some time.
This can be quite difficult for the soul...the emotions...to grasp, and hard as it may be, one must listen to the voice of the Spirit. The Holy Spirit will place secret hints and inclinations which, when followed, will keep us from making a wrong decision we would regret during our latter years.
-God made us to know Him.
-God made each of us different so we would know different aspects of His being.
-God made man an incredibly complex creation, in the likeness of Himself, because He is incredibly complex.
The very worse thing we can do is shun God when He draws near to us. This, more than anything, pains Him and explains the unearthly coldness one feels when one rejects Him. Fortunately, God desires us so much He forgives our cold shoulders and gives us grace. This is why relationships that go awry hurt more than anything else...since we are made in God's image and have an innate desire for intimacy that supersedes all other desires.
Because man is so complex, this does not mean any man should marry any woman. Nor does this mean any Christian man should marry any Christian woman. I suspect God designs us so that there are really only a very few truly compatible people for living their lives together.
If one looks to the animal kingdom, one can see this more clearly. Mountain lions and lynxes, though they live in the same places, eat the same animals, chase the same sheep, and love to sleep 20+ hours a day are simply not made to be together. Granted, mankind is the same species, but this does not mean two Christians are made to be together. God may have different plans for both, though they walk along the same path for some time.
This can be quite difficult for the soul...the emotions...to grasp, and hard as it may be, one must listen to the voice of the Spirit. The Holy Spirit will place secret hints and inclinations which, when followed, will keep us from making a wrong decision we would regret during our latter years.
29 December 2010
Spelunkering through Life
It is hard to fall in love when you live in a cave. You get used to the silence and safety of the rocky walls and develop a false sense of security. The path of life requires at least some intimacy, which if absent, makes the hard parts of the journey almost unbearably painful. It is during these difficult stages the emotions go numb and we become less human to others. Traveling with another helps when the spirit is weak as the two can help each other. When one travels alone, sometimes the flame of the spirit flickers due to the wind and the weather. With two, one can shield the other and keep both flames lit.
14 December 2010
19 November 2010
11 November 2010
Image
"Every man becomes the image of the God he adores. He whose worship is directed to a dead thing becomes a dead thing.
He who loves corruption rots.
He who loves a shadow becomes, himself, a shadow.
he who loves things that must perish lives in dread of their perishing."
--Thomas Merton in 'No Man is an Island'
He who loves corruption rots.
He who loves a shadow becomes, himself, a shadow.
he who loves things that must perish lives in dread of their perishing."
--Thomas Merton in 'No Man is an Island'
It's the Truth
"Man's intelligence, however we may misuse it, is far too keen and too sure to rest for long in error. It may embrace a lie and cling to it stubbornly, believing it to be true: but it cannot find true rest in falsehood. The mind that is in error wears itself out with anxiety, lest its error be discovered for what it is. But the man who loves truth can already find rest in the acknowledgement of his mistakes, for that is the beginning of truth."
--Thomas Merton in 'No Man is an Island'
--Thomas Merton in 'No Man is an Island'
27 October 2010
26 October 2010
25 October 2010
Sticky Stuff
24 October 2010
Atoms
Disregarding what is intuitively obvious means the mind must continually repress the natural order of Life. Over time, this repressing causes the mind to think (against one's better judgement) thoughts that are inconsistent with Reality. So that the end result can be only madness.
When a large enough population in a society represses the intuitively obvious, the logical thing that must happen is a shift in mores and a decline in creativity. The society becomes volatile to the extent that chaos becomes the norm and mediocrity a virtue.
Given a large enough number of people, one can predict what will happen in a manner somewhat analogous to the chemical and physical laws that govern gas particles in a system. And a wise and competent leader will foresee all this and make plans accordingly.
It's true that all people have Free-Will, can make cause-and-effect decisions, as do separate atoms in a closed system. Yet as any chemist or physicist will tell you, atoms by themselves don't do much to their society alone. It takes billions of them to make an impact.
When a large enough population in a society represses the intuitively obvious, the logical thing that must happen is a shift in mores and a decline in creativity. The society becomes volatile to the extent that chaos becomes the norm and mediocrity a virtue.
Given a large enough number of people, one can predict what will happen in a manner somewhat analogous to the chemical and physical laws that govern gas particles in a system. And a wise and competent leader will foresee all this and make plans accordingly.
It's true that all people have Free-Will, can make cause-and-effect decisions, as do separate atoms in a closed system. Yet as any chemist or physicist will tell you, atoms by themselves don't do much to their society alone. It takes billions of them to make an impact.
12 October 2010
Bolivian Gas
I was not planning to blog tonight, but after drinking the equivalent of 4 cups of coffee with the consistency of Bolivian diesel fuel...and I'm not certain it was not Bolivian diesel fuel (who can tell with all the sugarcane)...I changed my mind.
Coffee is not something I drink much of nowadays. I found myself addicted to it and switched to tea. And anyone who appreciates tea knows the impossibility of getting addicted to tea. Even good tea.
In retrospect, it wasn't so much the taste of coffee I craved-it was the kick. One day after a few too many cups, I went a little crazy and searched E-Bay with the honest-to-goodness intention of importing a colony of jackalopes from Borneo. I thought their presence would make a more than interesting addition to the chemistry lab I work at. Then Reason, that lovely goddess who should really rear her head more often than she does in chemistry labs in this great country of ours, actually did rear her head and tell me to stop the online shopping thing and get back to work.
OK Jason. You've written enough for one night. Let's hope nobody with a good psychologist and telephone number offers you 'Life' advice.
Coffee is not something I drink much of nowadays. I found myself addicted to it and switched to tea. And anyone who appreciates tea knows the impossibility of getting addicted to tea. Even good tea.
In retrospect, it wasn't so much the taste of coffee I craved-it was the kick. One day after a few too many cups, I went a little crazy and searched E-Bay with the honest-to-goodness intention of importing a colony of jackalopes from Borneo. I thought their presence would make a more than interesting addition to the chemistry lab I work at. Then Reason, that lovely goddess who should really rear her head more often than she does in chemistry labs in this great country of ours, actually did rear her head and tell me to stop the online shopping thing and get back to work.
OK Jason. You've written enough for one night. Let's hope nobody with a good psychologist and telephone number offers you 'Life' advice.
29 September 2010
15 September 2010
Randomness in September
Most decisions made by men nowadays are based strictly upon emotional states. Logic and foresight are secondary factors in their day-to-day plans. If you don't believe me go to Kentucky or Southern West Virginia and see for yourself the results of decades upon decades of emotion based choices.
A dream I had: As I went walking through the woods I heard a voice calling, "Whoo?...Whooo?"
I thought it must be the Voice of Wisdom calling me in the form of an angel. Then I saw the feathers, beak, and small rodent in the beak flying overhead and at once my heart lightened with good cheer. I composed a proverb on the spot, "Woe to those who call black white, white black, and gray grey. For they are colorblind and destined to become British. Radical alterations of Reality without foresight lead to simpletonism and the end thereof is a Life of Misery in a cold wretched trailer in Southern Appalachia where there will be weeping and gnashing of gums. Confusion shall be in your right hand and ignorance of proper hygiene in your left. Ye shall be friend to the dogs and have far too many non-regulated chemicals in your bloodstream."
Sometime later I woke from the trance and swore off canned mushrooms from Big Lots with expiration dates from 1984.
A dream I had: As I went walking through the woods I heard a voice calling, "Whoo?...Whooo?"
I thought it must be the Voice of Wisdom calling me in the form of an angel. Then I saw the feathers, beak, and small rodent in the beak flying overhead and at once my heart lightened with good cheer. I composed a proverb on the spot, "Woe to those who call black white, white black, and gray grey. For they are colorblind and destined to become British. Radical alterations of Reality without foresight lead to simpletonism and the end thereof is a Life of Misery in a cold wretched trailer in Southern Appalachia where there will be weeping and gnashing of gums. Confusion shall be in your right hand and ignorance of proper hygiene in your left. Ye shall be friend to the dogs and have far too many non-regulated chemicals in your bloodstream."
Sometime later I woke from the trance and swore off canned mushrooms from Big Lots with expiration dates from 1984.
27 August 2010
Shafted by the elevator
Dropping one's hotel key down the space between the elevator and the hallway...into the nether regions of the building...to be lost forever...except possibly by a guy who vaguely resembles Cornelius from Planet of the Apes..and appears on World's Dirtiest Jobs w/Mike Rowe...is NOT the best way to start the day.
29 July 2010
Superglue is a Man's Best Fiend
"It is neva a good date when U aksidently superglue your thumb 2 your pinky finger...makes typin' hardt.....
18 July 2010
11 July 2010
"If the feet and hands had a will of their own, they could only be in their order in submitting this particular will to the primary will which governs the whole body. Apart from that, they are in disorder and mischief; but in willing only the good of the body, they accomplish their own good." --Blaise Pascal
09 July 2010
Help Wanted
I discovered the following ad this morning on Craigslist and felt compelled to reply.
Reanimator (New Orleans)
--------------------------------------------------------------------------------
Date: 2010-06-24, 1:58PM CDT
Reply to: xxxxxxxxxxxxx@craigslist.org [Errors when replying to ads?]
--------------------------------------------------------------------------------
I am seeking a scientist interested in "re-animation technology". I want to create zombies in order to kill them. Or to keep them as pets. Not sure which yet. To do so, you must be familiar with the CNS and how death affects its functioning. I have some basic ideas on how to create a zombie but fresh ideas are always welcome.
Location: New Orleans
Compensation: Depends on zombie creating ability
Telecommuting is ok.
This is a part-time job
My Response:
Good Morning,
I saw your recent ad in Craigslist and think I have the requisite knowledge, skills, and abilities necessary to re-animate previously dead...and almost dead...creatures. While my success rate has not been the greatest in recent years, I think re-animation is what I have designed to do in Life-as-we-know-it.
Some of my past projects have involved grasshoppers, bees, a former boss, neighborhood cats, and two old men by the local Amtrak station.
The first man resembled a mannequin; the second resembled the first man but talked even less. Neither got invited to many parties, had wooden personalities, and enjoyed watching old Hee-Haw re-runs for hours on end with nary so much as moving a finger. I discovered, quite by accident, that the electric fence I had built around my cubicle could be adjusted to shoot a bolt of electricity towards the two tv watchers. Generally speaking, their response was limited to either, "yup...yup...yup or u-huh...u-huh."
Enclosed you will find my current resume along with a link to my Paypal account.
Perhaps we can arrange a telephone interview?
Regards,
Jason M. Parrish
Reanimator (New Orleans)
--------------------------------------------------------------------------------
Date: 2010-06-24, 1:58PM CDT
Reply to: xxxxxxxxxxxxx@craigslist.org [Errors when replying to ads?]
--------------------------------------------------------------------------------
I am seeking a scientist interested in "re-animation technology". I want to create zombies in order to kill them. Or to keep them as pets. Not sure which yet. To do so, you must be familiar with the CNS and how death affects its functioning. I have some basic ideas on how to create a zombie but fresh ideas are always welcome.
Location: New Orleans
Compensation: Depends on zombie creating ability
Telecommuting is ok.
This is a part-time job
My Response:
Good Morning,
I saw your recent ad in Craigslist and think I have the requisite knowledge, skills, and abilities necessary to re-animate previously dead...and almost dead...creatures. While my success rate has not been the greatest in recent years, I think re-animation is what I have designed to do in Life-as-we-know-it.
Some of my past projects have involved grasshoppers, bees, a former boss, neighborhood cats, and two old men by the local Amtrak station.
The first man resembled a mannequin; the second resembled the first man but talked even less. Neither got invited to many parties, had wooden personalities, and enjoyed watching old Hee-Haw re-runs for hours on end with nary so much as moving a finger. I discovered, quite by accident, that the electric fence I had built around my cubicle could be adjusted to shoot a bolt of electricity towards the two tv watchers. Generally speaking, their response was limited to either, "yup...yup...yup or u-huh...u-huh."
Enclosed you will find my current resume along with a link to my Paypal account.
Perhaps we can arrange a telephone interview?
Regards,
Jason M. Parrish
05 July 2010
5 July 2010. The Odyssey Continues
According to my calendar, I have not posted anything of much substantialness in a really long time. I must confess I've been spending time on Facebook mindlessly checking the minutia of people I haven't seen in ages. It's starting to become an addiction...sort of like I had to watch G.I. Joe everyday when in grade school.
I promise to post more often here soon...just as soon as I check my status updates.
I promise to post more often here soon...just as soon as I check my status updates.
27 June 2010
22 May 2010
Deoxyribonucleic Acid
Contrary to rumors, the Meaning of Life is more than
ATCGTGCATCTAGCTAGCTAGGTCGATCATATAGCTAGGCATACCATGACAAAC
TGCATGCTCGACTGGGCTACTAGCTGACTGGCGATCTTAAGCCCATGGGACTAC
TCCTAGCATCACCATGATCGATTCAGCTCATGCATCCATTTTACGCTAGTCGAT
ACCAACTTCGTCATCGTGCATCTAGCTAGCTAGGTCGATCATATAGCTAGGCAT
TGCATGCTCGACTGGGCTACTAGCTGACTGGCGATCTTAAGCCCATGGGACTAC
TCCTAGCATCACCATGATCGATTCAGCTCATGCATCCATTTTACGCTAGTCGAT
ACCAACTTCGTCACCATGACAAACACCATGACAAACGGAATTCCATACTGGCTA
ATCGTGCATCTAGCTAGCTAGGTCGATCATATAGCTAGGCATACCATGACAAAC
TGCATGCTCGACTGGGCTACTAGCTGACTGGCGATCTTAAGCCCATGGGACTAC
TCCTAGCATCACCATGATCGATTCAGCTCATGCATCCATTTTACGCTAGTCGAT
ACCAACTTCGTCATCGTGCATCTAGCTAGCTAGGTCGATCATATAGCTAGGCAT
TGCATGCTCGACTGGGCTACTAGCTGACTGGCGATCTTAAGCCCATGGGACTAC
TCCTAGCATCACCATGATCGATTCAGCTCATGCATCCATTTTACGCTAGTCGAT
ACCAACTTCGTCACCATGACAAACACCATGACAAACGGAATTCCATACTGGCTA
ATCGTGCATCTAGCTAGCTAGGTCGATCATATAGCTAGGCATACCATGACAAAC
TGCATGCTCGACTGGGCTACTAGCTGACTGGCGATCTTAAGCCCATGGGACTAC
TCCTAGCATCACCATGATCGATTCAGCTCATGCATCCATTTTACGCTAGTCGAT
ACCAACTTCGTCATCGTGCATCTAGCTAGCTAGGTCGATCATATAGCTAGGCAT
TGCATGCTCGACTGGGCTACTAGCTGACTGGCGATCTTAAGCCCATGGGACTAC
TCCTAGCATCACCATGATCGATTCAGCTCATGCATCCATTTTACGCTAGTCGAT
ACCAACTTCGTCACCATGACAAACACCATGACAAACGGAATTCCATACTGGCTA
ATCGTGCATCTAGCTAGCTAGGTCGATCATATAGCTAGGCATACCATGACAAAC
TGCATGCTCGACTGGGCTACTAGCTGACTGGCGATCTTAAGCCCATGGGACTAC
TCCTAGCATCACCATGATCGATTCAGCTCATGCATCCATTTTACGCTAGTCGAT
ACCAACTTCGTCATCGTGCATCTAGCTAGCTAGGTCGATCATATAGCTAGGCAT
TGCATGCTCGACTGGGCTACTAGCTGACTGGCGATCTTAAGCCCATGGGACTAC
TCCTAGCATCACCATGATCGATTCAGCTCATGCATCCATTTTACGCTAGTCGAT
ACCAACTTCGTCACCATGACAAACACCATGACAAACGGAATTCCATACTGGCTA
ATCGTGCATCTAGCTAGCTAGGTCGATCATATAGCTAGGCATACCATGACAAAC
TGCATGCTCGACTGGGCTACTAGCTGACTGGCGATCTTAAGCCCATGGGACTAC
TCCTAGCATCACCATGATCGATTCAGCTCATGCATCCATTTTACGCTAGTCGAT
ACCAACTTCGTCATCGTGCATCTAGCTAGCTAGGTCGATCATATAGCTAGGCAT
TGCATGCTCGACTGGGCTACTAGCTGACTGGCGATCTTAAGCCCATGGGACTAC
TCCTAGCATCACCATGATCGATTCAGCTCATGCATCCATTTTACGCTAGTCGAT
ACCAACTTCGTCACCATGACAAACACCATGACAAACGGAATTCCATACTGGCTA
ATCGTGCATCTAGCTAGCTAGGTCGATCATATAGCTAGGCATACCATGACAAAC
TGCATGCTCGACTGGGCTACTAGCTGACTGGCGATCTTAAGCCCATGGGACTAC
TCCTAGCATCACCATGATCGATTCAGCTCATGCATCCATTTTACGCTAGTCGAT
ACCAACTTCGTCATCGTGCATCTAGCTAGCTAGGTCGATCATATAGCTAGGCAT
TGCATGCTCGACTGGGCTACTAGCTGACTGGCGATCTTAAGCCCATGGGACTAC
TCCTAGCATCACCATGATCGATTCAGCTCATGCATCCATTTTACGCTAGTCGAT
ACCAACTTCGTCACCATGACAAACACCATGACAAACGGAATTCCATACTGGCTA
A Little Bit of Ying; A Little Bit of Yang
14 May 2010
Telemarketer
Ring...ring...ring
"Hello?"
"This is the minding other people's better business bureau telemarketing agency at an unknown location in America and various sites in Nigeria. How are you today?"
"Swell. And you?"
"Fine sir. We would like to yabba dadda yabba bubba ....."
"Sorry to interrupt, but I believe you have the wrong person. This is the U.S office of the Häagen-Dazs Proper Verb Conjugation Society. Where our motto is:
I Scream
You Scream
We All Scream for Ice Cream
So unless you are asking for advice on how to relieve ice cream headaches due to Cherry Garcia and other commonly mis-spelt words, I should like to bid you farewell and have an ice day. Good-bye."
(The above conversation is not an unusual occurrence in my life)... No kidding...
"Hello?"
"This is the minding other people's better business bureau telemarketing agency at an unknown location in America and various sites in Nigeria. How are you today?"
"Swell. And you?"
"Fine sir. We would like to yabba dadda yabba bubba ....."
"Sorry to interrupt, but I believe you have the wrong person. This is the U.S office of the Häagen-Dazs Proper Verb Conjugation Society. Where our motto is:
I Scream
You Scream
We All Scream for Ice Cream
So unless you are asking for advice on how to relieve ice cream headaches due to Cherry Garcia and other commonly mis-spelt words, I should like to bid you farewell and have an ice day. Good-bye."
(The above conversation is not an unusual occurrence in my life)... No kidding...
04 May 2010
The Game of Life
It came in a flash of insight. A revelation. A paradigmatic shift of consciousness. This time without the mushrooms.
Where there's a will, there's a way.
Where there's a way, there's a door.
Where there's a door, there's a knob.
Where there's a knob, there's a key.
Where there's a key, it'll probably get lost.
If it gets lost, it can be found by a good metal detector...
(This was a rather long epiphany and can be read in it's entirety in a future post)
I'll not bore you with the details but the end of the revelation was the answer to the Meaning of Life. More specifically, the meaning to Life-as-we-now-know-it. Not the next-life-as-some-of-us-will-know-it and certainly not life-in-any-previous-sort-of-existence.
The Meaning of Life is that life is essentially a game. A virtual reality game in which all the world's a stage and we're all the players. There's a small percentage of people that are actually stage props, but as they all now work for an un-named government agency we can disregard them for the time being.
Life, see, isn't really real. At least real as we usually think of the term real. It's virtual. The plan is for us to learn how to maneuver through all the different levels until time runs out or our energy levels deplete. In some cases, people really mess up and get removed from the system, but this is rare.
This virtual existence also explains spoon bending, the Bermuda Triangle, the rash of vanishing hitch-hikers on the West Coast, the occasional kidney heist, those hooks you sometimes see hanging on the doorway of your girlfriends house, UFOs, straight A's after your college roommate takes an extended vacation, and the Laws of Economics.
The secret is-we are not alone in the universe. Michael Jackson was right...you are not alone. Our actual bodies are hanging in some sort of hibernaculum/cocoon-like thing with tubes, wires, sensors, and probes all monitoring our every move.
Some of our more enlightened muses have even hinted around to our larval lives.
"Every breath you take and every move you make
Every bond you break
Every step you take, I'll be watching you
Every single day and every word you say
Every game you play"
--lyrics by Sting, boldness by me
Those beings you call angels are actually the hyper-somatic lab techs keeping us in the system. Some of the bad ones with plans of their own...the demons...keep trying to do their hack jobs. Occasionally, when things get slow, the angels will put on the VR gear and come into our sphere to do a little work...nudge us along...iron out the kinks...then step behind a tree and vanish.
Does this mean all those vanishing hitch-hikers in Los Angeles are angels?
Yep.
Does this mean all those hobos living under your neighborhood bridge are angels?
Nope.
Most of these are actual virtual real-life hobos...the ones you can smell. If they smell good, they might be hyper-somatic beings, people writing a book, or U.S. census workers trying to fit in. The rule of thumb is...if they smell like h.e. double l...they're not from heaven.
Where there's a will, there's a way.
Where there's a way, there's a door.
Where there's a door, there's a knob.
Where there's a knob, there's a key.
Where there's a key, it'll probably get lost.
If it gets lost, it can be found by a good metal detector...
(This was a rather long epiphany and can be read in it's entirety in a future post)
I'll not bore you with the details but the end of the revelation was the answer to the Meaning of Life. More specifically, the meaning to Life-as-we-now-know-it. Not the next-life-as-some-of-us-will-know-it and certainly not life-in-any-previous-sort-of-existence.
The Meaning of Life is that life is essentially a game. A virtual reality game in which all the world's a stage and we're all the players. There's a small percentage of people that are actually stage props, but as they all now work for an un-named government agency we can disregard them for the time being.
Life, see, isn't really real. At least real as we usually think of the term real. It's virtual. The plan is for us to learn how to maneuver through all the different levels until time runs out or our energy levels deplete. In some cases, people really mess up and get removed from the system, but this is rare.
This virtual existence also explains spoon bending, the Bermuda Triangle, the rash of vanishing hitch-hikers on the West Coast, the occasional kidney heist, those hooks you sometimes see hanging on the doorway of your girlfriends house, UFOs, straight A's after your college roommate takes an extended vacation, and the Laws of Economics.
The secret is-we are not alone in the universe. Michael Jackson was right...you are not alone. Our actual bodies are hanging in some sort of hibernaculum/cocoon-like thing with tubes, wires, sensors, and probes all monitoring our every move.
Some of our more enlightened muses have even hinted around to our larval lives.
"Every breath you take and every move you make
Every bond you break
Every step you take, I'll be watching you
Every single day and every word you say
Every game you play"
--lyrics by Sting, boldness by me
Those beings you call angels are actually the hyper-somatic lab techs keeping us in the system. Some of the bad ones with plans of their own...the demons...keep trying to do their hack jobs. Occasionally, when things get slow, the angels will put on the VR gear and come into our sphere to do a little work...nudge us along...iron out the kinks...then step behind a tree and vanish.
Does this mean all those vanishing hitch-hikers in Los Angeles are angels?
Yep.
Does this mean all those hobos living under your neighborhood bridge are angels?
Nope.
Most of these are actual virtual real-life hobos...the ones you can smell. If they smell good, they might be hyper-somatic beings, people writing a book, or U.S. census workers trying to fit in. The rule of thumb is...if they smell like h.e. double l...they're not from heaven.
20 April 2010
Fenway
I saw this little creature on youtube and decided I want one as a pet. The only thing I need is one river and a bag of otter chow.
16 April 2010
Buffalo Burgers
I went to Trader Joes this morning meaning to purchase a fan. I needed a new fan to blow smoke fumes outside-now that the stove is fixed. I've never been a smoker of tobacco products-just stuff like meat, eggs, mushrooms, leeks, onions, and various other members of the plant/animal/fungus/mineral kingdoms...basically anything that requires heating in a cast-iron skillet.
I thought Trader Joes was a discount store, but it's not. It's a grocery store that specializes in organic, green, environmentally-friendly, and bio-degradable food. It also sells Dentyne but I don't think Dentyne is bio-degradable unless you live near Chernobyl or Three-mile Island.
At first, I thought to leave without buying anything, but as everybody knows you cannot enter a grocery store without making a purchase. You can't say, "Oh, I'm just looking," like you can sometimes do at 7-11 from the hours between midnight and six A.M....at least without a straight face and a mask of some sort.
Since I had all the food and Dentyne I desired, I explored the aisles looking at the non-pesticided, free-ranging, organic plants and dead animals for sale. I discovered some buffalo meat labeled, 'raised without antibiotics or hormones.' Which I thought was a swell idea as injecting a creature 6 foot high at the shoulder, covered with black bristly hair, and sporting tusks with steroids was never a good idea. I figure guys like this already have enough issues in life.
Six hours later, in an experiment the likes of which I shall never try again, I drove to the neighboring park to run 6 miles. I won't say how far I got but I can assure you there is a very good reason why you never see any Olympic gold medalist attribute their performance to bison cheeseburgers on rye bread.
I thought Trader Joes was a discount store, but it's not. It's a grocery store that specializes in organic, green, environmentally-friendly, and bio-degradable food. It also sells Dentyne but I don't think Dentyne is bio-degradable unless you live near Chernobyl or Three-mile Island.
At first, I thought to leave without buying anything, but as everybody knows you cannot enter a grocery store without making a purchase. You can't say, "Oh, I'm just looking," like you can sometimes do at 7-11 from the hours between midnight and six A.M....at least without a straight face and a mask of some sort.
Since I had all the food and Dentyne I desired, I explored the aisles looking at the non-pesticided, free-ranging, organic plants and dead animals for sale. I discovered some buffalo meat labeled, 'raised without antibiotics or hormones.' Which I thought was a swell idea as injecting a creature 6 foot high at the shoulder, covered with black bristly hair, and sporting tusks with steroids was never a good idea. I figure guys like this already have enough issues in life.
Six hours later, in an experiment the likes of which I shall never try again, I drove to the neighboring park to run 6 miles. I won't say how far I got but I can assure you there is a very good reason why you never see any Olympic gold medalist attribute their performance to bison cheeseburgers on rye bread.
15 April 2010
I must buy this today.
"As foretold by ancient prophets, an apocalypse destroyed Earth during the twenty-first century. But two thousand years later Elyon set upon the Earth a new Adam. This time, He gave humanity an advantage. What was once unseen became seen. It was good and it was called . . . Green. But the evil Teeleh bided his time in a Black Forest. Then, when least expected, twenty-four-year-old Thomas Hunter fell asleep in our world and awoke in that future Black Forest."
Green: The Beginning and the End (Thorndike Press Large Print Christian Fiction)
by Ted Dekker
Green: The Beginning and the End (Thorndike Press Large Print Christian Fiction)
by Ted Dekker
09 April 2010
Dear Noah Webster
Dear Noah Webster,
You know that big book you wrote about the English language?
Yeah...the one with about 200 additions?
Nobody reads it anymore.
You should write another one with pictures and hieroglyphics and post it on Facebook along with coupons for free Happy Meals.
Regards,
Jason
You know that big book you wrote about the English language?
Yeah...the one with about 200 additions?
Nobody reads it anymore.
You should write another one with pictures and hieroglyphics and post it on Facebook along with coupons for free Happy Meals.
Regards,
Jason
Subscribe to:
Posts (Atom)

